Principles of Inheritance & Variation (Genetics) Questions and Answers

C 0 00 0 43 One trait will mask or cover up an other trait Two alleles fora trait separate during gamete formation Alleles for different traits separ in Speed 1x a Principle of Dominance C 10 b Principle of Independent Assortm Principle of Segregation Paus

4 Imagine that you are a doctor in a maternity ward During your last shift 20 babies were born 10 had blue eyes and 10 had brown eyes Remember genc are the two alleles given for each trait written with a letter For this activity B brown eyes b blue eyes Phenotypes are the physical appearance of the Considering the possible genotypes you listed in question 3 what traits would the parents of brown eyed and blue eyed children have to have Explain yo answer by creating a table like the one below and completing the Punnett square to show the genotypes Create a table by clicking on the Insert Table icon which looks like a grid on the far right Genotypes Phenotypes B b T

Imagine that you are a doctor in a maternity ward During your last shift 20 babies were born 10 had blue eyes and 10 had brown eyes Remember genotypes are the two alleles given for each trait written with a letter For this activity B brown eyes b blue eyes Phenotypes are the physical appearance of the trait What percentage of babies have Brown and Blue eyes to find percent divide total number of blue eyed babies by the total number of babies born You should get a decimal number Just use the first two numbers as the percent If your answer is 25 you would have 25 You must write your answers using your own words Note

A homozygous dwarf tomato plant with a hairy stem was crossed with a homozygous tall tomato plant with a hairless stem Assume normal Mendelian genetics applies to these traits Explain how the genes are carried in the subsequent generations using the following symbols to represent the different alleles Recessive allele for a dwarf tomato plant t Dominant allele for a tall tomato plant T Recessive allele for a hairy tomato plant h Dominant allele for a hairless tomato plant H Complete the following details Phenotypes of parent plant Genotypes of parent plants All possible gametes All possible genotypes of F1 Phenotypes of F1 First cross dwarf with hairy stem crossed with tall with hairless stem These F1 plants were then cross pollinated seeds collected and grown the following year Complete the Punnett square below to show all possible genotypes of the F2 generation of tomato plants gametes

When a ribosome cannot dissociate from an mRNA molecule it depletes the pool of ribosomes available to the cell This problem is solved by all of these mechanisms EXCEPT Both a and b no go decay nonstop mRNA decay a tmRNA which transfers a ribosome that has stopped onto a different RNA molecule nonsense mediated decay

Genetics Review Part 1 For the following fill in the blank questions use these terms co dominance phenotype allele Incomplete dominance 4 Type of cell that produces gametes or sex cells Sex cell 5 A trait is found on X or Y only Usually it is seen more in a specific gender heterozygous sex linked homozygous 1 An alternate form of a gene Allele 2 Recessive trait shows through dominant tralt Heterzygote has blend of both traits Incoplete donatione Homozygas 3 Both alleles are the same genotype B silent mutation D point nonsense mutation germ cell Somaticell 6 Physical look of an organism Phenotype 7 Both traits are seen in heterozygote Traits are equally dominant codo Monice 8 Both the alleles are different gene type 9 What the genes actually say 10 Type of cell that produces body cells 9 cell 11 Which of the following mutations would have the greatest effect on the organism A frameshift mutation C point missense mutation somatic cell 12 Sickle cell anemia a homozygous disease that changes the shape of red blood cells occurs because of a A chromosomal mutation 8 Insertion of 2 nucleotides C point mutation in 1 codon D deletion of 1 nucleotide Original DNA sequence TGATCAGGACTTACA B TGATCAGGACTATACA C GN gn 13 Baldness is a sex linked trait What parental genotypes could produce a bald woman H normal hair and h bald B xHxhxxHy A xHxHxxhy C xHxhxxhy D xhxh xxHy 14 Which of the following is an example of a frameshift mutation A TGATCAGGACGTACA 15 If a mouse has the genotype GgNn what are the possible genetic combinations that could be present in a single egg or sperm cell A GN only B Gn GN gN D GN gn gN and Gn 16 A recessive sex linked disease that impairs the body s ability to clot when cut is called B Tay sachs disease A Sickle Cell Anemia 29 C TGCTCAGGACTTACA D TGATGAGGACTTACA C Hemophilia D Huntington s disease 1 In huma b Explain son th 17 Would a gene mutation or a chromosomal mutation be more severe in an organism Explain why with evidence Genetics Problems 2 Albink canno speck plan 3 You plan Just 4 In all ur E 5 0

Why fruit color of summer squash shows dominant epistasis ODue to interaction of two dominant non alleles O Due to the phenotypic effect of allefes at one gene that masks the phenotypic effect of the alleles of another gene O Due to the existence of alleles of a gene pair in heterozygous condition Due to the influence of a single gene over multiple phenotypic traits

The figure below shows a pedigree for the inheritance of a phenotype in a family Which of the following is correct O Father Affected Mother Normal Son Affected Daughter Normal O Father Affected Mother Normal Son Normal Daughter Affected O Father Normal Mother Affected Son Affected Daughter Normal O Father Normal Mother Normal Son Normal Daughter Affected

the F generation of Mendel s experiment one out of four plants had white flowers because both parents were heterozygous white O both parents were heterozygous purple O one parent was homozygous recessive n thot

Which statement best describes the biogeography of species observed by Charles Darwin OA Species spread rapidly so geographical distance between species is unrelated to their evolution B Species cannot evolve if they are separated from their ancestors by distance or a barrier O C Species that are separated geographically by barriers rarely share common ancestors D Species that are farther apart geographically tend to be more distantly related

As a population declines in numbers it gains genetic diversity O True O False

Which type of RNA guides chemical modifications of other RNAS A TRNA C tRNA B snoRNA D snRNA

9 For the admix tests what do genetics companies use to tell you what percent of DNA you have from around the world They make a random guess about which genes they expect to find from people around the world They see how closely your genetic sample resembles the reference group samples from around the world in their database They scramble your DNA in a lab and see how it sorts out on a machine 10 What does 23 refer to in the genetic company name 23 and Me 1 point The number of pairs of chromosomes humans have The total number of chromosomes humans have The number of genes humans have The number is not significant it just a number they liked 1 point

7 Thomas Jefferson did not have any legitimate sons with his wife Martha that survived to adulthood Why did Dr Foster want to use the Y chromosome from Thomas Jefferson s paternal uncle s male descendants to compare to a male line descendent of Sally Heming s youngest son O O He could have used any of Jefferson s relatives it was just easier to find people on his uncle s line Because Jefferson s uncle s Y chromosome was more healthier than his Y chromosome Because his uncle s family line is easier to trace the ancestry of Because both Jefferson s father and his father s brother should have the same Y chromosome that was passed on to Jefferson 8 Both mtDNA and Y chromosomes get passed down from generation to generation virtually unchanged 1 point O True False 1 point

5 Why did the scientists use King Richard III sister s descendants to match to his mtDNA O Because they could have chosen any of his descendants they just had an easier time finding this family line Because they expected the mtDNA of Richard III not to match his sister Because mtDNA is only passed on to the next generation only by females even though everyone gets it from mom Because mtDNA is similar in all family members 6 Scientists did not find a Y chromosome match between Richard III s skeletal remains and his paternal uncle s male line descendants What could be a plausible explanation for this 1 point There was a break in the paternity in the male line and someone other than the claimed father is the father of one of the descendants Y chromosome testing is not accurate and cannot be relied upon The Y chromosome changes a lot from O generation to generation because of recombination 1 point Richard III and his paternal uncle would not hare the com V

DNA 0 adder AmoebaSisters MULTIPLE CHOICE QUESTION 3 1500bp YouTu Which fragment will travel the FURTHEST from the well

In rabbits the homozygous CC is normal Cc results in rabbits with deformed legs and cc is lethal For a gene for coat color the genotype BB produces black Bb brown and bb a white coat The number of rabbits that are normal with white coat when a cross is made between a deformed brown rabbit with a deformed white rabbit is 1 8 O2 6 O 3 8 4 6

DTO TO oft OTO BO O Co dominant O Dominant O Incompletely dominant Recessive

Several orchards in different regions were planted with apple trees produced from a single parent tree The table below shows data gathered from the three apple orchards Which of the characteristics in the table below are most likely inherited and not affected by the environment Location Average May Full Bloom Ripe Fruit Temperature Date Color C Tyler TX Austin TX Victoria TX 22 24 25 O Full bloom date O Ripe fruit color May 22 May 17 May 10 O Average temperature O Days from bloom to harvest Green Green Green Average Fruit Size g 252 263 237 Days From Bloom to Harvest 143 147 150

Which of the following alleles control the blood type O A OB O O

Which of the following refers to an alternate form of a gene in the same position on a pair of chromosomes O Loci O Allele O Genes O Chromosome

hich of the following statements is NOT true about an X linked recessive trait O The trait is always passed on from father to son O The trait is inherited by the male children through their mothers O The trait is more likely to affect the males than the females in the family O The trait is typically passed on from an affected grandfather to the grandson through carrier daughter

The pedigree given below shows I II III 2 3 TO Q OAY linked recessive trait O An autosomal dominant trait O An X linked dominant trait O An X linked recessive trait 6

Taste blindness is the inability of individuals to identify PTC a bitter tasting chemical The pedigree below shows the inheritance of taste blindr family Which of the following best describes the trait It is a Y linked dominant trait It is an aut dor ant t It is an autosomal recessive trait It is an X linked dominant trait

Down Syndrome is caused by which of the following mutations A only 45 total chromosomes B only an X chromosome and nothing else C two X chromosomes and a Y D three copies of the 21st chromosome

What does the following symbol in a pedigree chart represent O O Mating O Identical twins O Affected

The figure below shows a pedigree The trait inherited in this family is a O dominant O O non dominant Orecessive trait

1 Mice collected from the Sonoran desert have two phenotypes dark D and light d The mice shown below were collected in a trap Calculate Dames F choro A The frequency of individuals that display the recessive trait dd This is your q value 7 B The frequency of recessive alleles in the population d This is your q value 86 C The frequency of dominant alleles D This is your p value S D The percentage of individuals that are homozygous dominant DD 2 4 E The percentage of mice in the population that are heterozygous Dd This is 2pq F Suggest a reason for the number of d alleles in the population 1 pra

a of their parents grandparent to child in question who is blood group O Considering only the ABO blood characteristic explain all the possible blood groups their child could have Your answer should identify the probabilities for each of these blood types Describe a way in which it would be possible to determine the genotype of a man with A type blood Consider the genotype of the mother and the phenotype of their children What conclusive evidence would be required and what would it show

In humans thick eyebrows are dominant to narrow and separated are dominant to joined unibrow Daniel has a very thick unibrow and is worried his future children will as well He is surprised he even has one since his mother has narrow and separated eyebrows just like his wife Minju Minji s dad has a unibrow Give the genotype for each parent Father What is the chance that Daniel has children who look like him What is the chance they look like his wife What is the most likely eyebrow phenotype of their offspring What is its likelihood

Explain whether the haemophilia allele is dominant or recessive In the space below and using appropriate symbols predict the phenotype and gender of all pos offspring for a female carrier of haemophilia and a normal male You should include a fully labe Punnett square in your answer and provide a definition of the symbols you use for each allele

Recall that in Mendel s peas yellow is dominant to green and round is dominant to wrinkled Parent plants where one is homozygous for yellow and wrinkled peas and the other is homozygous for green and round peas produce an F1 generation The F plants self fertilize One of the F2 pods contains 6 peas What is the chance that all 6 peas are green and round Multiple Choice 18 16 3 16 6 16 1166 1 6 O 6 166 3 16 6 9 16 6

Evolution is one of the unifying themes of biology Evolution involves change in the frequencies of alleles in a population For a particular genetic locus in a population the frequency of the recessive allele a is 0 4 and the frequency of the dominant allele A is 0 6 a What is the frequency of each genotype AA Aa aa in this population What is the frequency of the dominant phenotype b How can the Hardy Weinberg principle of genetic equilibrium be used to determine whether this population is evolving c Identify a particular environmental change and describe how it might alter allelic frequencies in this population Explain which condition of the Hardy Weinberg principle would not be met d In fruit flies Drosophila melanogaster straight wing shape is dominant to curly wing shape A particular population of fruit flies is in Hardy Weinberg equilibrium with respect to the alleles for wing shape The Hardy Weinberg equation given below is useful in understanding population genetics p 2pq q 1 Explain what the terms p 2pq and q represent in the population of fruit flies

Rabbits may have brown or white fur Assume that the inheritance of fur colour depends on the transmission of a single gene via a single pair of alleles in accordance with Mendelian principles It was found that if a homozygous white male buck was crossed with a homozygous brown female doe all their offspring in the F1 generation had brown fur Use the symbols B and b to represent the alleles for fur colour Which colour is the dominant in this example Explain what evidence you have to support your choice If two heterozygous rabbits are bred what would be the appearance of the offspring Complete the Punnett square genetic diagram below to clarify your answer Remember to write in the allele type for the gametes of both the buck and doe

The ABO blood type is an example of O Dominance O Blending O Incomplete dominance O Codominance O Sex linkage

17 cod in 18 20 tomora Phase AZ sogressm Met UAC 19 AUGCCUAGUCGGUAAAAAAAAA Sul to find dimodis 21 3 First the initiation phase takes place The two pieces of the ribosome the small ribosomal subunit and the large ribosomal subunit come together at the 5 end of messenger RNA The first transfer RNA carrying the first amino acid Met enters the A site The anticodon of this tRNA aligns with the codon of the mRNA Highlight the first tRNA s anticodon in one color and the start codon and the first amino acid in the same color of bodocus ai blas hud nobox ins s r bolls do diw quinq low DAU not

pel the diagrams as you read the following passage 22 24 23 Phase Met Pro GGA Ser UCA Translation Part 3 Met Pro Next the elongation phase begins The ribosome moves along the messenger RNA and the start codon along with the first tRNA move into the P site leaving the A site open for the next tRNA The next codon in this case CCU moves into the A site and the tRNA with the matching anti codon GGA enters the A site as well When the amino acids Met and Pro are next to each other in the A and P sites the ribosome promotes a reaction to form a bond between the two amino acids starting the amino acid sequence of the new protein Highlight the second tRNA s anticodon the second codon and the second amino acid with the same color different from the first Arg Class ACCOUAGUCGGUAAA AUGCCUAGUEGGUAAAAAA 5 Date Met Pro GGA Ser AUGCCUAGUCG 3 Highlight the third anticodon codon amino acid with a new color Do the same for the 4th C 2015 Bethany Lau GCC 3 As the elongation phase continues the first tRNA without its amino acid moves into the E exit site The amino acid is now attached to the other amino acid attached to the second tRNA which has moved in the P site The A site is now open for the next tRNA to enter The next tRNA with the anti codon UCA aligns with the codon AGU in the A site The string of Met Pro attaches to the new amino acid Serine Ser when that tRNA moves into the P site and as the second tRNA enters the E site This process continues until the ribosome s A site detects a stop codon

Label the diagrams as you read the following passage 22 24 23 Phase Translation Part 3 Met Pro S A Class AUGCO 05M Date OGGUAAAAAAAAA 3 Next the elongation phase begins The ribosome moves along the messenger RNA and the start codon along with the first tRNA move into the P site leaving the A site open for the next tRNA The next codon in this case CCU moves into the A site and the tRNA with the matching anti codon GGA enters the A site as well When the am dRaiton the ribosome promotes a reaction to

Free earlobes are dominant over attached earlobes If two people with attached earlobes mate what will be the phenotype of their offspring O all free earlobes O all attached earlobes O 50 50 free to attached earlobes O 75 free 25 attached 4

Name Label the diagrams as you read the following passage AUDO 17 20 12 13 m Translation is the process cells use to build new proteins using messenger RNA instructions The ribosome acts as the location for translation The ribosome is made up of two large pieces the large ribosomal subunit and the small ribosomal subunit There are three sites that are important for translation The aminoacyl A site is on the right in the diagram above The peptidyl P site is in the middle and the exit E site is on the left in the diagram above There are three main phases or steps in the process the Initiation Phase the Elongation Phase and the Termination Phase 14 18 Translation Part 2 Phase Met UAC 16 15 19 AUGEGUAGUCGGUAAAAAAA 21 3 First the initiation phase takes place The two pieces of the ribosome the small ribosomal subunit and the large ribosomal subunit come together at the 5 end of messenger RNA The first transfer RNA carrying the first amino acid Met enters the A site The anticodon of this tRNA aligns with the codon of the mRNA Highlight the first tRNA s anticodon in one color and the start codon and the first amino acid in the same color

ck Question 38 What type of blood can an offspring of parents who both have type A blood have O Type A only O Type A and O Type A B and O O All blood types are possible because this only gives us the phenotypes not the specific genotypes

mRNA O Ribosome O tRNA is the product of transcription O Codon O Anticodion

estion 94 woman with type A blood has a child with a man who is type B blood Is it possible for the child to have type O bod Yes 1p No

What is transcription The manufacture of a strand of RNA complementary to a strand of DNA O The manufacture of a protein based on information carried of RNA O The manufacture of two new DNA double helices that are identical to an old DNA double helix O The manufacture of a new strand of DNA complementary to an old strand of DNA O The modification of a strand of RNA prior to the manufacture of a protein

Question 88 Choose the following letter designation for attached unattached earlobes that represents homozygous recessive genotype EE Ee 1 pt ee

All of these karyotypes are aneuploid EXCEPT one of them Which ONE is the exception O A 45 X OB 69 XXX O C 47 XXY O D 47 XY 21 O E 47 XYY

Which one of the combinations of egg and sperm chromosomes is the best explanation for the origin of the karyotype in a male exhibiting Klinefelter s syndrome 4 XXY OA egg chromosomes 23 autosomes plus X sperm chromosomes 22 autosomes plus X OB egg chromosomes 23 autosomes plus X sperm chromosomes 23 autosomes neither X nor Y O C egg chromosomes 22 autosomes neither X nor Y sperm chromosomes 22 autosomes plus X O D egg chromosomes 22 autosomes plus X sperm chromosomes 22 autosomes plus X and Y F egg chromosomes 22 autosomes neither X nor Y

A trait s heritability is the proportion of its variation tha cannot be explained is the product of genes and environment O results from the environment alone O is inherited

Mendel s Data Mendel performed similar crosses with other F plants Each time he crossed plant showing different versions of a trait and observed parental traits that were absent the F generation in the F plants In all cases the offspring of these crosses showe many plants with one version of a trait and some plants with the alternate version FIGURE 6 Mendel observed parental traits when he allowed the F plants to self fertilize Ratio Traits Parental Cross F Generation F Generation 5474 round 1850 wrinkled Seed shape Seed color Flower color Stem length round x wrinkled yellow green purplex white tall x short all round all yellow all purple all tall 6020 yellow 2001 green 705 purple 224 white 787 tall 277 short ANALYZE What patterns do you notice in Mendel s data 2 96 1 3 01 1 3 15 1 2 84 1

in guinea pigs the allele for black cost color B is dominant over white coat color b When two black guinea pigs are crossed they produce 15 black pigs and 8 white pigs If you were to perform a chi square test with this information what would be your chi square value 11 7 O 0 5 O 1 17 O 0 75 O 0 117