Question:
the DNA sequence below to answer the following questions
Last updated: 5/14/2023

the DNA sequence below to answer the following questions vena horla 8 noiloo2 5 bns beylovni me 1 mark i ii iii 3 TACGAACGAGTGCCCCAAAATT polo What is the complementary DNA strand vilena s r What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand 1 mark Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence 2 marks