Question:
U CI PROBLEM 8 Given the following DNA sequence
Last updated: 2/12/2023

U CI PROBLEM 8 Given the following DNA sequence CGAATCCGTATGCGTACAAGCTGCTATGO 1st 2nd 3rd 1 Assume the sequence is on the coding strand a Assume that the first reading frame was us corresponding polypeptide b Assume that the second reading frame was corresponding polypeptide was 11