The Living World Questions and Answers

Biology
The Living WorldWhich vitamin is synthesized by microbes in the intestine and helps to maintain bone health?
vitamin A
vitamin D
vitamin E
vitamin K

Biology
The Living WorldThis picture shows an object in space that has an icy core with a tail of gas and dust that extends millions of miles. What is this?
A star
A comet
An asteroid
A moon

Biology
The Living WorldThe loudness of a sound is determined by what property of a sound wave?
Frequency
Wavelength
Velocity or rate of change
Amplitude or height

Biology
The Living WorldDuring metaphase 1, occurs in which homologous chromosomes align randomly with respect to other tetrads.
nondisjunction
contrasting alleles
DNA replication
genetic recombination
independent assortment

Biology
The Living WorldWhich of the following are correct statements concerning a gene?
They contain the information necessary to make a protein
They are hereditary sequences of DNA
They consist of three sequential coding nucleotides
Both A and B are correct

Biology
The Living WorldWhich of these terms is defined as the study of how the positions of stars and planets can influence human
behavior?
Astrology
Alchemy
Astronomy
Meterology

Biology
The Living WorldDuring the 18th century, what was England's view on inoculations?
Genetic research could be conducted based on innoculation
It was inferior medicine that would go away
It was the same process that England was already using
It was far superior to current treatments for smallpox

Biology
The Living WorldWhat step should you take first if a patient's primary insurance rejects a Third Party claim?
Bill the prescription to the patient's secondary indgrance
Contact the patient to tell them that they will have to call the Third Party plan
Attempt to resolve the rejection from the primary insurance
Run the prescription as cash

Biology
The Living WorldDissemination of research and other application of experimental methods will hopefully lend to which of the following?
widespread application of procedures that will lend to the betterment of society
the development of an echo chamber, a community that congratulates itself for generating great ideas
a dogmatic approach to clinical practices
refinement of procedures and eventually their replacement by better applications

Biology
The Living WorldWhich of these people developed the polio vaccine?
Marie Curie
Isaac Newton
Albert Einstein
Jonas Salk

Biology
The Living World"Not only was this an unlawful event, but it will surely be remembered as one of Virginia's most horrifying as well. Let this be a warning to us all, that the abolitionists would shed many a tear for the black slave, but not one for the white who dies at the hand of that slave who rises up against him.” The above statement is most likely referring to what event?
the Seneca Falls Conference
the Trail of Tears
the introduction of the Wilmot Proviso
Nat Turner's Rebellion

Biology
The Living WorldWhy do you think some people still believe in a link between autism and vaccines despite scientific studies that show no such connection exists? Select all that apply.
O Continued reference to the Wakefield study
O Stories on social media
O Word of mouth stories
O Celebrity campaigns

Biology
The Living WorldWhich of the following statements about radionuclide scanning is INCORRECT?
Regions of intense color represent low activity and high radionuclide content.
O The computer displays the image in color on a video monitor.
The radioactive substance is applied intravenously.
The emitted gamma rays are detected and fed to a computer.

Biology
The Living WorldPhysicians take a sample of smokers and nonsmokers and record the time it takes them to fall asleep on seven consecutive nights. What is the variable of interest?
A. The physicians
B. The average time it takes to fall asleep on the seven nights
C. The smokers and nonsmokers
D. The amount of time it takes to fall asleep each night

Biology
The Living WorldWhich is the meaning of the Latin root "viv"?
to live
to glow
to see
to conquer

Biology
The Living WorldYou have learned about many forms of lipids. Which of the following would not be considered correct in regards to lipids?
The number of kinks, or double bonds present in the molecule determines the shape and characteristics of the lipid
Males and females contain different types of lipids
Phospholipids are a single layer of lipids that make up the cell membrane
Certain types of lipids can adversely affect your health

Biology
The Living WorldWhen a blood vessel is damaged, platelets attach and recruit more platelets to the area. These new platelets recruit even more, quickly increasing the number of platelets until the damage is sealed with a blood clot. This amplification is an example of
Multiple Choice
positive feedback.
negative feedback.

Biology
The Living WorldEuropean countries believed that power depended on wealth. They thought that there was only so much wealth in the world and a country could only become rich at the expense of another country. This idea can best be described as
A. mercantilism.
B. colonialism.
C. communism.
D. feudalism.

Biology
The Living WorldWhat does the following sentence from the essay "An Appeal to Congress for Impartial Suffrage" by
Frederick Douglas depict?
"But why are the Southerners so willing to make these sacrifices? The answer plainly is, they see in
this policy the only hope of saving something of their old sectional peculiarities and power."
Opposing claim
Evidence for a claim
A statement intended toward the audience
None of the choices

Biology
The Living World11. Location of a Membrane Protein The following observa- tions are made on an unknown membrane protein, X. It can be extracted from disrupted erythrocyte membranes into a concen- trated salt solution, and it can be cleaved into fragments by proteolytic enzymes. Treatment of erythrocytes with proteolytic enzymes followed by disruption and extraction of membrane components yields intact X. However, treatment of erythrocyte "ghosts" (which consist of just plasma membranes, produced by disrupting the cells and washing out the hemoglobin) with prote- olytic enzymes followed by disruption and extraction yields ex- tensively fragmented X. What do these observations indicate about the location of X in the plasma membrane? Do the proper- ties of X resemble those of an integral or peripheral membrane protein?

Biology
The Living WorldIn New France, the king held all the powers of government through his appointed officials. The officials implemented and enforced all of the king's orders. The English colonies, however, were not all governed by the king of England. For example, Pennsylvania was a proprietary colony. This meant that an individual or a group of land owners chosen by the king, known as proprietors, had the authority to govern themselves.
Which statement is true regarding the government structures of New France and the English colonies?
A. New France and the English colonies were established with the understanding that the king or queen would oversee all aspects of society.
B. New France was governed by the king, while some English colonies had authority to govern themselves.
C. Both New France and the English colonies ruled without any interference from their country's respective king or queen.
D. The English colonies were ruled by the king or queen who granted the charters, while New France had complete autonomy,

Biology
The Living WorldWhich of the following is not an example of homeostasis?
Maintaining blood pH by hyperventilating
Maintaining body temperature by sweating
Maintaining body temperature by putting on a hoodie
Maintaining blood glucose levels by releasing insulin

Biology
The Living WorldClick and drag on elements in order
Rank the following in order from smallest mass (at the top) to largest mass (at the bottom).
Instructions
atom
proton
electron

Biology
The Living WorldA conclusion ending with a question
makes readers think of the problem addressed in the essay
makes readers a part of the story
makes readers think of the thesis statement
All of the choices
![2. You might have noticed that in space exploration, attention is often focused on the presence or absence of water on other planets. What characteristics of water make it as essential for life as we know it on Earth? [2.5]](https://media.kunduz.com/media/sug-question/raw/53768421-1657377384.813762.jpeg?w=256)
Biology
The Living World2. You might have noticed that in space exploration, attention is often focused on the presence or absence of water on other planets. What characteristics of water make it as essential for life as we know it on Earth? [2.5]

Biology
The Living WorldWhich of the following is true of positive feedback?
Positive feedback mechanisms are independent of negative feedback loops.
The change is opposite that of negative feedback.
The effector turns off the response.
The change is amplified.

Biology
The Living WorldIn a conclusion you should restate your in a different way, maintaining the same overall meaning.
thesis statement
topic
main points

Biology
The Living WorldWhich level of organization in the human body involves two or more tissue types working together to perform specific, complex functions?
Organ level
Organismal level
Tissue level
Cellular level

Biology
The Living WorldWhich of the following theories is falsifiable? Select the best answer.
Happiness is more important than money.
Grocery store A has a greater variety of ice cream than grocery store B.
The Beatles are the best band in history.

Biology
The Living WorldWhen there is a change in the internal body environment, how will the body react to maintain homeostasis by negative feedback?
Oppose the change
Do nothing
Wait and see if the external environment will change
Amplify the change

Biology
The Living WorldAn individual with a protein deficiency typically experiences increased susceptibility to illnesses, muscle and joint pain, and difficulty concentrating. Why does a protein deficiency cause such diverse symptoms?
because proteins are the primary source of energy for many different cell types
because the membranes of immune, muscle, and nervous system cells consist entirely of proteins
because immune, nervous, and muscle system cells require proteins for structure and regulation
because the only role of proteins is to provide the enzymes that all cells need to function

Biology
The Living WorldWhen Lashley found that memories for learned behaviors could not be located in a that ...
memories "migrate" through the brain depending on their importance
he needed more refined microsurgical techniques
memories involve changes to both structure and function
all areas of the brain are equally important in learning

Biology
The Living WorldWhich statement describes fibrous joints?
They are freely moveable joints.
They are also known as partly moveable joints.
They are fluid-filled joints.
They are also known as fixed joints.

Biology
The Living WorldWhen mRNA is translated, each of the codons below codes for serine.
• UCU
• UCC
• UCG
• UCA
When translated, which of the following DNA sequences would lead to a serine amino acid in the peptide.
ATGGGTCAAATCGTGTACTGA
ATGGGTCTAATCGGGTTCTGA
ATGCGTCAAAACGTCTACTGA
ATGGGTCAAAGCGTGTCCTGA

Biology
The Living WorldThe striatum is particularly important when learning information that_
needs to be integrated over many trials
is most responsive to delayed feedback
is critical to the formation of explicit memories
is involved in the development of flexible responses

Biology
The Living WorldWhat kind of energy transformation takes place when plants perform photosynthesis to produce glucose molecules?
A. conversion of radiant energy into chemical energy
B.conversion of chemical energy into radiant energy
C.conversion of heat energy into mechanical energy
D.conversion of mechanical energy into heat energy

Biology
The Living WorldPhotoexcitation occurs when:
a) electrons in chlorophyll molecules are at their ground state
b) a photon of light is absorbed by electrons in chlorophyll molecules
c) electrons have their highest potential energy
d) plants display fluorescence

Biology
The Living WorldHow do whales differ from fish?
A.Whales use blowholes for breathing.
B.Whales have scales that cover their skin.
C.Whales develop lungs following metamorphosis.
D. Whales reproduce through external fertilization.

Biology
The Living WorldWhat other role does acetyl CoA have in the body besides entering the Kreb's cycle?
a) acetyl CoA molecules can combine to create fatty acids
b) 2 acetyl CoA molecules combine to from 1 molecule of oxaloacetate.
c) acetyl CoA molecules can be converted to more molecules of CO₂
d) acetyl CoA molecules can be converted to more molecules of NADH

Biology
The Living WorldIdentify three formal factors that affect Egypt's regionalization. These are the common human or environmental properties that Egypt shares with its neighbors. Find a formal factor that connects Egypt to Africa, to Europe, and to Southwest Asia. (5 points)

Biology
The Living WorldWhat can be inferred from the following statement? "Though the debate continues to rage on human clinical trials versus animal testing, the fact remains that there are very few alternatives left for organizations."
It shows the author's opinion
It is a fact and a counterclaim
It is representing the claim
!["As he looks at the painting of a heath Mr. Carslake imagines walking on it with a variety of companions, longing for the intimacy and social equality that he sees as characteristic of al fresco conversation in contrast to polite small talk: Why, very likely they would talk about their own habits for a whole hour; and all in the freest, easiest way, so that suppose he, or Mabel Waring, or Stuart [...] wanted to explain Einstein or make a statement - something quite private perhaps - (he had known it happen) - it would come quite natural." What type of supporting information is used in the excerpt?
Facts
Block quotations
Examples](https://media.kunduz.com/media/sug-question/raw/73435857-1657374632.8346105.jpeg?w=256)
Biology
The Living World"As he looks at the painting of a heath Mr. Carslake imagines walking on it with a variety of companions, longing for the intimacy and social equality that he sees as characteristic of al fresco conversation in contrast to polite small talk: Why, very likely they would talk about their own habits for a whole hour; and all in the freest, easiest way, so that suppose he, or Mabel Waring, or Stuart [...] wanted to explain Einstein or make a statement - something quite private perhaps - (he had known it happen) - it would come quite natural." What type of supporting information is used in the excerpt?
Facts
Block quotations
Examples

Biology
The Living WorldWhich among the following contributes to the entire research content?
(i) Summary of the content
(ii) The topic of the content
(iii) Answer to the self-generated question
Option (i) only
Option (i), (ii) and (iii)
Option (i) and (iii) only

Biology
The Living WorldWhat is the purpose of the following line from the essay "Simple Songs Virginia Woolf and Music" by Emma Sutton? "The short story 'A Simple Melody encapsulates her acute interest in music and its resonant but discreet place in her work."
This line identifies the question and supports the introduction.
This line offers testimony.
This line contradicts the title.

Biology
The Living WorldWhat does the following sentence from the transcript "1980 Ronald Reagan/Jimmy Carter Presidential Debate" depict? "The new economic revitalization program that we have in mind, which will be implemented next year, would result in tax credits which would let businesses invest in new tools and new factories to create even more new jobs-about a million in the next 2 years."
Opposing statement
Evidence
Claim

Biology
The Living WorldWhich supportive information type is used here? "Within a couple of years, when he was a student at Jesus College, Cambridge, Sterne experienced the first symptoms of the consumption - pulmonary tuberculosis - that would haunt him for the remainder of his life. Much later, when traveling abroad for his health, he vividly recalled the very moment: "I had the same accident I had at Cambridge, of breaking a vessel in my lungs. It happened in the night, and I bled the bed full"."
Extended definition
Facts
Quotation

Biology
The Living WorldWhat does the following sentence from the transcript "Public meeting on the High Cost of Living" by President Calvin Coolidge depict? "The humblest American citizen has the right to the protection of his Government by every force that Government can command."
Evidence for the counterclaim
False claim
Indicates a claim

Biology
The Living WorldChief Justice John Marshall wrote, "It is emphatically the province and duty of the judicial department to say what the law is" in which opinion?
McCulloch v. Maryland
Marbury v. Madison
Brown v. Board of Education

Biology
The Living WorldWhat modern people want to be made to understand is simply that all argument begins with an assumption; that is, with something that you do not doubt. (2) You can, of course, if you like, doubt the assumption at the beginning of your argument, but in that case you are beginning a different argument with another assumption at the beginning of it. (3) Every argument begins with an infallible dogma, and that infallible dogma can only be disputed by falling back on some other infallible dogma; you can never prove your first statement or it would not be your first. (4) All this is the alphabet of thinking. (5) And it has this special and positive point about it that it can be taught in a school, like the other alphabet. (6) Not to start an argument without stating your postulates could be taught in philosophy as it is taught in Euclid, in a common schoolroom with a blackboard. (7) And I think it might be taught in some simple and rational degree even to the young, before they go out into the streets and are delivered over entirely to the logic and philosophy of the Daily Mail. In sentence 1 (reproduced below), the writer is considering deleting the bolded text. What modern people want to be made to understand is simply that all argument begins with an assumption; that is, with something that you do not doubt. Should the writer keep or delete the bolded text?
Keep it, because it clarifies what the writer means by the word "assumption."
Keep it, because it is essential to the line of reasoning which will follow.
Delete it, because it adds unnecessary wordiness without adding meaning.
Delete it, because it contradicts the line of reasoning which will follow.

Biology
The Living WorldWhat is the definition of "periodically" as used in this selection?
Rhythmic, or phasic, smooth muscle contracts periodically. It spends most of the time in a relaxed state. Tonic smooth muscle remains contracted for the majority of the time and only relaxes periodically.
A for long stretches
B from time to time
C randomly but frequently
D using an exact schedule