Circulation Questions and Answers

Please read the following passage and then answer the questions about the study described below Researchers conducted a study to determine the effects of watching the television show Doctor Who on individuals self reported levels of happiness In the study one group is assigned to watch Doctor Who and then answer a short happiness level survey and the other group is simply asked to answer the happiness survey without watching the show 18 In the study described above level of happiness represents the A A Standard deviation B Independent variable C Control D D Dependent variable E E Confound

7 What form of psychology pioneered by William James and heavily influenced by Charles Darwin s theory of evolution states that the mind is more complex than individual elements and should be view more relative to the building it makes not the bricks meaning how it is used A A Psychoanalysis B B Existentialism C C Structuralism D D Functionalism E E None of the Above

uestion 1 Which of the following is true about sleep deprivation a It is not possible to completely make up what is lost from sleep deprivation b If you are sleep deprived for one night you will probably gain weight Oc If you are sleep deprived for one night your body will have difficulty sleeping the next night d If you are sleep deprived for one night your body will make up for it the next night

question 5 Mind wandering is an example of the role of a conscious thought b correcting mistakes self regulation c d the default mode network

278 UNIT 13 Gross Anatomy of the Muscular System 5 Identify the following skeletal muscles in anterior view a b C d hh e ff f g h gg ee dd i j k m 1 n CC O P 9 bb T S t aa u V W X y Z a b n O P q r S t u V W X jj kk 11 f g h ii kk 11 mi

According to James and Lange feelings of emotions only occur when we verbally express ourselves to others precede emotional responses are by products of behavioral and physiological responses are experienced directly

O Macmillan Learning Hydrolysis of the N glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic AP site An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair Examine the structure of an AP site H N HN N o Guanine 0 P O CH 0 N H HN H N N Select the chemical consequences that could contribute to DNA instability at AP sites fewer hydrogen bonds between the unpaired pyrimidine base and water decreased interaction between the mutated DNA strand and histones KH H H O VH disruption of the base stacking interactions increased ability of the deoxyribose ring to open without the attachment of the purine base H 6 6 O P O CH 0 OH Guanosine residue in DNA O H H H O Apurinic residue H H

Urinary bladder Uterus D Internal urethral sphincter ng and Stom m Peritoneum

What is the Rule of Four O four Supreme Court Justices must agree to hear a case four Supreme Court Justices decide the ruling on a case Oif fewer than four Supreme Court justices agree they will not rule on the case O no more than four Supreme Court justices can come from the same political party

Indicate for each of the following if it is more likely to be lateralized to the LEFT or RIGHT hemisphere Solving jigsaw puzzles Select Right Left Speech production Recognizing melodic patterns Select Speech comprehension Select Socio emotional interpretations Select Understanding plot structure Sarcasm Select Select Fine motor control of hand Select

Again indicate for each of the following whether the newborn s anatomy will be likely to appear primarily Female or Male The fetus developed a very large Sexually Dimorphic Nucleus The fetus was Androgen Insensitive The fetus had a normal Y chromosome The fetus was XO Turner s syndrome Choose Female Male Chorus Choose Choose

Indicate for each of the following whether the newborn s anatomy will be likely to appear primarily Female or Male The fetus has a TDF deficit The fetus developed a normal Wolffian system As a teen the person s secondary hair growth is mainly a result of gonad rather than adrenal activity The fetus had two normal X chromosomes The fetus produced Anti Mullerian Hormone Choose Male Female Choose Choose Choose Choose

63 Edema is characteristic in O a marasmus O b kwashiorkor

81 As a nurse you have a newly diagnosed patient with the following labs I cholesterol 307 II HDL Chol 45 III glucose 250 IV triglycerides 450 Which do you addresses first Ob N OCM Od B

ion Practice Complete the lines below by determining the mRNA transcript and amino acid sequence Compare the mutant DNA strands to the wild type strand Circle the mutation in the mutant DNA strands and describe the type of mutation frameshift in point missense point silent or point nonsense Not all of these will be frameshift deletion this assignment Wild type DNA template mRNA transcript sequence Amino acid sequence 3 TACGCGTGCACGATGCAGTAGTACATC5 Mutation 1 DNA template 3 TACGCGTGCACGATCCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence Type of mutation Mutation 2 DNA template 3 TA CGCGTGCTCGATGCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence Type of mutation Mutation 3 DNA template 3 TA CGCGCTGCACGATGCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence ype of mutation Mutation 4 DNA template 3 TACGCGTGCACGATGCAGTAATACATC5 RNA transcript sequence

What does the old timer from Sulphur Creek tell the man in To Build a Fire A To never travel alone when it s colder than fifty below OB To watch out for water hidden beneath the snow C To make sure to remove the ice from his dog s paw D To put food against the body to keep it from freezing

For a researcher measuring test scores on an examination the best measure of central tendency is which of the following assume test scores are normally distributed O Mode Mean O Median

Which is a correct description of hypertonic solution 1 A solution with the same solute concentration as a cell s intracellular solution 2 A solution with greater solute concentration as the cell s intracellular solution 3 A solution with less solute concentration as the cell s intracellular solution

a Raise the bed rails Get a grab bar b c Lock brake the bed wheels Remove the person s shoes d 10 A transfer gait belt is applied To the skin a b Over clothing at the waist Over the breasts c d Over a colostomy or ileostomy site 11 To safely use a transfer gait belt you must a Follow the manufacturer s instructions Be able to slide a closed fist under the belt c Leave the belt on if the person is left alone d Position the buckle over the person s spine b 12 You apply a transfer gait belt What should you do with the excess strap a Cut it off b Wrap it around the person s waist Tuck it into the belt Let it dangle c d 13 A person starts to fall Your first action is to Try to prevent the fall Call for help a b c d Lower the person to the floor Bring the person close to your body 14 When a bariatric person falls you should a Try to stop the fall b Do nothing c d Quickly pull the person close to you Try to protect the person s head adiband 15 You found a person lying on the floor What should you do a Lock the bed wheels back to bad

1 These statements are about falls Which is true a Most are caused by many risk factors b Serious injuries are unlikely c Falling indoors is not common d Nursing center residents are at decreased risk 2 Which person has the lowest risk of falls a A 75 year old with confusion b A 68 year old with a history of falls CA 60 year old with a hearing aid d An 80 year old with urinary incontinence 3 A person s care plan includes fall prevention measures Which should you question a Assist with elimination needs b Keep phone lamp and TV controls within reach c Unlock bed wheels when giving bedside care d Complete a safety check after visitors leave the room 4 You observe the following in the person s room Which is unsafe The lamp cord is by the chair The chair has armrests a b c The night light is on d The bed is in a low position 5 You note the following after a person is dressed Which is safe a Pant cuffs are dragging on the floor b The person is wearing slip resistant shoes c The belt is not fastened d The shirt is too big 6 A resident s care plan includes use of a position change alarm You hear the alarm sound What should you do a Find the resident s nursing assistant b Tell the nurse c Assist the person right away d Wait for someone to respond to the alarm 7 To help prevent falls you need to report a Equipment and supplies being on 1 side of the hallway b A floor cushion beside the bed c A co worker pulling a wheelchair through a doorway d A loose grab bar safety bar in a bathroom 8 Bed rails are used a b c When you want to use them d For persons at high risk for bed entrapment For all persons According to the care plan

82 Can the oral temperature site be used if a person have convulsive seizures der page 331 Page 390 box 31 2 L 83 Should the person be standing or lying down when taking their blood pressure page 403 box 31 4 84 What is the normal blood pressure range page page 401

69 Brady cardia and tachycardia page 396 70 What is the normal pulse rate page 396 71 Hypotension and hypertension page 401 72 Blood pressure page 401 73 Pulse rate page 396

de or False Mark T for true or F for false 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Unless otherwise ordered take vital signs with the person standing Before use a glass thermometer is rinsed under warm running water If a person is receiving oxygen an oral temperature is taken When taking a rectal temperature privacy is important Axillary temperatures are more reliable than oral temperatures To use a tympanic membrane thermometer the covered probe is inserted gently into the ear The brachial artery is used most often for taking a pulse Before using a stethoscope wipe the earpieces and diaphragm with antiseptic wipes A stethoscope is used to take an apical pulse An apical pulse is counted for 30 seconds Respirations are counted right after taking a pulse The person should be unaware that you are counting respirations I TIH Blood pressure is normally measured in the brachial artery The blood pressure cuff is applied over clothing If you cannot hear a blood pressure tell the nurse at once Pain is different for each person

24 Which is not a reason to keep intake and output 180 records A To evaluate fluid balance B To evaluate kidney function C To measure vital signs D To monitor special fluid orders 25 Which is not a guideline for measuring weight and height A The person wears comfortable clothes B The person voids before being weighed C The person is weighed at the same time of day D The scale is balanced at zero 0

A tissue whose extracellular matrix is fluid and which has three types of cells the most common of which is enucleate lacking a nucleus would be which of the following O neuroglia epithelia blood bone lymph

O is a complex combination of carbohydrates and proteins is composed of a bilayer of proteins O is composed of a bilayer of lipids O is composed of only carbohydrate molecules O is a complex combination of carbohydrates and lipids QUESTION 2 Which of these removes worn out organelles and does for the cell what the immune system does for the human body endoplasmic reticulum ribosome Omitochondrion O lysosome O integral proteins QUESTION 3 What are the membrane structures that function in active transport O carbohydrates integral proteins cholesterol O peripheral proteins QUESTION 4

S Identify the highlighted component of hyaline cartilage

In the potato experiment you had potato cores soaking in different concentrations of sucrose solution 0 M 0 2M 0 4M and 0 6M sucrose Which potato lost the most weight Explain

1 List the order of putting PPE on Googles mask Goien Wisk Googles and Gloves 2 What does the acronym of RACE stand for Color and Racial 3 What does the acronym of PASS 4 Which is a symptom A Skin redness B Vomiting C Pain D Yellow Urine 5 In the evening the clock shoes 10 44 a m What time is it in military time 1044 Pull Aim Spray Spoil List the order of the bath 10 points A Feet face B Face C Stomach D Hapos E Chest F Back G Legs H Vagina 1 Arms Puttocks arms Hands Chest stomach Leas Feet Vaalna Back Buttock

Oval window Ty Question 25 2 points 4 Listen

he Left 0 57 57 Mohamed Salad Attempt 1 Question 13 2 points Listen The of the cerebrum controls skeletal muscle Primary motor area Prefrontal cortex O Frontal eye field Gustatory area

piva viguiiu Small Intestine Question 10 2 points Listen 26 Arachnoid villi return cerebr

Which of the following is not a vein of the upper lim Multiple Choice O O O O Cephalic vein Great saphenous vein Basilic vein Median antebrachial vein

31 15 A renal pyramid voids urine into the Multiple Choice minor calyx major calyx renal medulla renal papilla ureter

are found especially in the mucous membrane standing guard against parasites and allerg Multiple Choice O O Monocytes Lymphocytes Basophils Neutrophils

Term Constitutional Article 2 Constitutional Article 3 Federalists Anti Federalists Bill of Rights Definition Image Senten

10 These thermometers measure temperatures in 3 to 4 seconds They are non invasive A B

u need to discard contaminated needles an sharp instruments in containers that are These containers are color coded in and and have the symbol 22 List the times you need to decontaminate work surfaces A B C 23 What should you use to clean up broken glass

Please describe the process of Dialysis and why is it needed

23 To successfully complete the competency evaluation how many attempts does OBRA allow you A Only one attempt B At least two attempts C At least three attempts D At least four attempts 24 The nursing assistant registry is A A skills evaluation B A list of rules and responsibilities for nursing assistants C An official listing of persons who have successfully completed an approved NATCEP D A procedure book 25 OBRA has requirements to ensure the competency of nursing assistants A For nursing assistants who have not worked for 24 months B Whenever a nursing assistant changes jobs C If a nursing assistant has a poor performance review D Whenever a nursing assistant is accused of abuse 26 Nursing assistants A Are an assistant to the nurse B Decide what should or should not be done for a person C Supervise other nursing assistants D Take telephone orders from the doctor 27 The nurse asks you to perform a task that is not your job description You should A Perform the task after the nurse shows you how B Refuse to perform the task and explain why C Ask a co worker to assist you with the task D Report the nurse to the administrator 28 The nurse asks you to apply an ankle brace to a patient s right ankle You do not understand the directions What should you do A Ask the patient to tell you how to apply the brace B Ask the nursing assistant who cared for the patient yesterday to show you how to apply the brace C Ask another nursing assistant to apply the brace D Explain to the nurse that you do not understand the instructions 29 You agree to perform a task You must do the following except A Complete the task safely B Ask for help when you are unsure C Report what you did and your observations to the nurse D Delegate the task to another nursing assistant if you are busy 30 You can refuse to perform a delegated task for the following reasons except A The task is not in your job description B You do not know how to use the equipment You do not want to perform the task because is unpleasant D The nurse s directions are unclear 31 Nursing assistants do not delegate A True B False 32 Which is not a standard for nursing assistants A Respecting the person s decision B Carrying out the directions and instructions the nurse if you have time C Functioning as a member of the health team D Keeping the person s information confiden 33 An RN asks you to perform a task beyond the legal limits of your role You agree to perform task Harm is caused Who is responsible A You and the RN B Only the RN C Only you D The entire nursing team 34 Sometimes refusing to follow the nurse s directions is your right and duty A True B False

LI the skeletal system Breaks down old and damaged bone Regulates the level of calcium in the blood The process of making new bone The process of replacing cartilage with bone Forms new bone tissue Monitors the mineral content of the bone

Intercalated discs and pacemaker cells are characteristic of 1 cardiac muscle tissue 2 skeletal muscle tissue 3 smooth muscle tissue 4 A B and C

Watch a tutorial video on how to calculate relative humidity Video length is 4 55 3 Based on the data table provided on the left side of Figure 6 4 plot the maximum water vapor of an air parcel in the blank graph on the right Connect the points with a solid line Max Water Vapor g H 0 kg air 0 1 0 3 Temperature C 40 30 20 10 0 5 10 15 20 25 30 35 40 0 75 2 3 5 5 7 10 14 20 26 5 35 47 Max Water Vapor g H 0 kg air 50 45 40 35 30 25 20 15 10 5 0 40 30 20 10 0 5 10 15 E Temperature C 20 25 30 35 40

Intramembranous ossification is used to form which bone listed O scapula O parietal bone Ohumerus O femur

ter 7 Matching arbone ver jaw lbone and bone ower leg bone high bone

Which part of the brain is responsible for processing visual information O Temporal lobe O Occipital lobe O Medulla O Parietal lobe

Which of the following is involved in the formation of long term memories Hypothalamus O Cerebellum Medulla OHippocampus

What is the functional role of platelet derived growth factor PDGF O It stimulates mitosis in smooth muscles and fibroblasts O It stimulates the division of platelets O It tightens the fibrin threads to cause clot retraction O It increases the fragmentation of megakaryocytes

drag on elements in order Beginning at the top list in order the events of platelet plug formation i Instructions Mass of platelets forms a platelet plug Platelets grow long spiny pseudopods Contact with collagen of a broken vessel or another rough surface Pseudopods contract and draw the vessel walls together

Blood flow through a capillary bed is regulated by precapillary sphincters True or False True False