Cell Cycle and Cell Division Questions and Answers

Question 2 Name This Phase of Mitosis E
Biology
Cell Cycle and Cell Division
Question 2 Name This Phase of Mitosis E
S 10 s sacca Instructure com courses 2452285 quizzes 5493540 take Name This Phase of Mitosis anaphase
Biology
Cell Cycle and Cell Division
S 10 s sacca Instructure com courses 2452285 quizzes 5493540 take Name This Phase of Mitosis anaphase
5 Identify the following ph A B
Biology
Cell Cycle and Cell Division
5 Identify the following ph A B
D Question 10 Which of the following happens during meiosis I Sister chromatids are separated Four daughter cells are formed The chromosome number per cell is conserved Homologous chromosomes of a pair are separated from each other Previous
Biology
Cell Cycle and Cell Division
D Question 10 Which of the following happens during meiosis I Sister chromatids are separated Four daughter cells are formed The chromosome number per cell is conserved Homologous chromosomes of a pair are separated from each other Previous
Question 12 Cytokinesis refers to movement of a cell from one place to another O division of the cytoplasm O reduction in the number of chromosomes O division of the nucleus Previous
Biology
Cell Cycle and Cell Division
Question 12 Cytokinesis refers to movement of a cell from one place to another O division of the cytoplasm O reduction in the number of chromosomes O division of the nucleus Previous
Question 6 Independent assortment of chromosomes during meiosis is a result of the relatively small degree of homology shared by the X and Y chromosomes O the random distribution of the sister chromatids to the two daughter cells during anaphase II O the random and independent way in which each pair of homologous chromosomes lines up at the metaphase plate during meiosis I O the random nature of the fertilization of ova by sperm
Biology
Cell Cycle and Cell Division
Question 6 Independent assortment of chromosomes during meiosis is a result of the relatively small degree of homology shared by the X and Y chromosomes O the random distribution of the sister chromatids to the two daughter cells during anaphase II O the random and independent way in which each pair of homologous chromosomes lines up at the metaphase plate during meiosis I O the random nature of the fertilization of ova by sperm
Figure 102 Refer to the drawings in Figure 10 2 of a single pair of homologous chromosomes as they might appear during various stages of either mitosis or meiosis Which diagram represents ana meiosss 10 OV
Biology
Cell Cycle and Cell Division
Figure 102 Refer to the drawings in Figure 10 2 of a single pair of homologous chromosomes as they might appear during various stages of either mitosis or meiosis Which diagram represents ana meiosss 10 OV
1 a True b False An important difference between prokaryotes and eukaryotes is the absence of a nuclear membrane in prokaryotes which means that the messenger RNA can begin to be ranslated into proteins while it is still being synthesized at an active gene
Biology
Cell Cycle and Cell Division
1 a True b False An important difference between prokaryotes and eukaryotes is the absence of a nuclear membrane in prokaryotes which means that the messenger RNA can begin to be ranslated into proteins while it is still being synthesized at an active gene
We inhale air that is over 70 nitrogen by volume and incorporate into our bodies before exhalation A 35 C 0 B 1 D 30
Biology
Cell Cycle and Cell Division
We inhale air that is over 70 nitrogen by volume and incorporate into our bodies before exhalation A 35 C 0 B 1 D 30
12 Both mitosis and meiosis are preceded by prophase O telophase interphase prometanhase
Biology
Cell Cycle and Cell Division
12 Both mitosis and meiosis are preceded by prophase O telophase interphase prometanhase
Which of the following is true about meiosis Results in four diploid cells O Used to replicate skin cells Requires two rounds of cell division Does not require interphase
Biology
Cell Cycle and Cell Division
Which of the following is true about meiosis Results in four diploid cells O Used to replicate skin cells Requires two rounds of cell division Does not require interphase
The histogram on the left shows a population s distribution of phenotypes before selection occurs The histogram on the right shows the distribution after selection Number of individuals Before selection Mode mean Phenotype value Which type of selection is shown O A Stabilizing B Directional C Nongenetic D Disruptive Number of individuals After selection Mode mean Phenotype value
Biology
Cell Cycle and Cell Division
The histogram on the left shows a population s distribution of phenotypes before selection occurs The histogram on the right shows the distribution after selection Number of individuals Before selection Mode mean Phenotype value Which type of selection is shown O A Stabilizing B Directional C Nongenetic D Disruptive Number of individuals After selection Mode mean Phenotype value
Add semicolons in the five word groups that need them mark the other word groups OK Example o blows bute enig 1 Cheryl s first run at a cross country meet on Long Island would certainly have impressed any coach every person watching was astounded by her perseverance Coach Thompson had warned her not to start too fast but to stay with the pack Just try to finish he said Jaloilo Too excited to follow his directions Cheryl took off at top speed at the starting gun moreover she did not slow down even after she was a hundred yards in front of everyone else RA210 100 101 Bad OET D alg vism of vetemo Cheryl kept that distance for most of the run she did not allow herself any slack Then with only a hundred yards to go Cheryl gave out she collapsed and fell down Immediately she got to her knees and started crawling She crawled toward the fin ish line not to the grassy area where runners who left the race were supposed to go She got up staggered a little farther and fell again Once more she started crawling Not able to get to her feet Cheryl continued to crawl after all she was nearly to the 2 3 4 5 6 7 Cheryl Toussaint s first run was an indication of her character and determination no one Di sin uniseguol do ga could find fault with her effort 8 finish line 9 She had almost reached the line when another runner passed her and won 10 I knew at that moment said her coach that this girl was going to be something special Her coach was right THIRDAVan Brly I
Biology
Cell Cycle and Cell Division
Add semicolons in the five word groups that need them mark the other word groups OK Example o blows bute enig 1 Cheryl s first run at a cross country meet on Long Island would certainly have impressed any coach every person watching was astounded by her perseverance Coach Thompson had warned her not to start too fast but to stay with the pack Just try to finish he said Jaloilo Too excited to follow his directions Cheryl took off at top speed at the starting gun moreover she did not slow down even after she was a hundred yards in front of everyone else RA210 100 101 Bad OET D alg vism of vetemo Cheryl kept that distance for most of the run she did not allow herself any slack Then with only a hundred yards to go Cheryl gave out she collapsed and fell down Immediately she got to her knees and started crawling She crawled toward the fin ish line not to the grassy area where runners who left the race were supposed to go She got up staggered a little farther and fell again Once more she started crawling Not able to get to her feet Cheryl continued to crawl after all she was nearly to the 2 3 4 5 6 7 Cheryl Toussaint s first run was an indication of her character and determination no one Di sin uniseguol do ga could find fault with her effort 8 finish line 9 She had almost reached the line when another runner passed her and won 10 I knew at that moment said her coach that this girl was going to be something special Her coach was right THIRDAVan Brly I
Question 86 Points 1 If a contract entered into one state is to be recognized in another state the clause that can be used is the interstate compact clause full faith and credit clause privileges and immunities clause O interstate commerce clause Complete Later Complete
Biology
Cell Cycle and Cell Division
Question 86 Points 1 If a contract entered into one state is to be recognized in another state the clause that can be used is the interstate compact clause full faith and credit clause privileges and immunities clause O interstate commerce clause Complete Later Complete
What is a benefit of bird migration What is a cost of bird migration
Biology
Cell Cycle and Cell Division
What is a benefit of bird migration What is a cost of bird migration
Sort the images and descriptions to match the corresponding phase of mitosis Sort each item to the appropriate bin Each phase should have one micrograph and one description Prophase Chromosomes are aligned in the middle of the cell by microtubules of the mitotic spindle PEUTIC SPIELE MICROUBLES METOTIC SPINDLE MICROUBLES OHROMOSOMES Prometaphase Chromosomes condense and microtubules begin to form the mitotic spindle Microtubules of the mitotic spindle shorten dividing chromosomes into the two ends of the cell Metaphase CROUBLES PETOTIC SPINDLE CHROMOSOMES Nuclear structure reforms around the chromosomes at each cell end creating two daughter nuclei Nuclear structure breaks down allowing microtubles to bind to individual chromosomes Anaphase HETOTIC SPOLE Telophase Reset
Biology
Cell Cycle and Cell Division
Sort the images and descriptions to match the corresponding phase of mitosis Sort each item to the appropriate bin Each phase should have one micrograph and one description Prophase Chromosomes are aligned in the middle of the cell by microtubules of the mitotic spindle PEUTIC SPIELE MICROUBLES METOTIC SPINDLE MICROUBLES OHROMOSOMES Prometaphase Chromosomes condense and microtubules begin to form the mitotic spindle Microtubules of the mitotic spindle shorten dividing chromosomes into the two ends of the cell Metaphase CROUBLES PETOTIC SPINDLE CHROMOSOMES Nuclear structure reforms around the chromosomes at each cell end creating two daughter nuclei Nuclear structure breaks down allowing microtubles to bind to individual chromosomes Anaphase HETOTIC SPOLE Telophase Reset
My Courses Course Home Syllabus Scores Purchase Options Pearson eText Study Area KHW 8 Mitosis Mitosis 1 of 3 Mitosis and the Cell View Available Hint s
Biology
Cell Cycle and Cell Division
My Courses Course Home Syllabus Scores Purchase Options Pearson eText Study Area KHW 8 Mitosis Mitosis 1 of 3 Mitosis and the Cell View Available Hint s
In the lysogenic cycle Ohost DNA is destroyed and viral DNA is replicated O a bacterium replicates without passing viral DNA to its daughter cells O viral DNA is destroyed and host DNA is replicated O a bacterium divides once before the lytic cycle is initiated O viral DNA is replicated along with host DNA
Biology
Cell Cycle and Cell Division
In the lysogenic cycle Ohost DNA is destroyed and viral DNA is replicated O a bacterium replicates without passing viral DNA to its daughter cells O viral DNA is destroyed and host DNA is replicated O a bacterium divides once before the lytic cycle is initiated O viral DNA is replicated along with host DNA
12 11 owing statements on dominance is correct A The terms dominant and recessive apply to alleles B The terms dominant and recessive apply to genotypes C The dominant allele is the one that is selected for D The dominant allele is the most common in the population E The recessive allele expresses its phenotype even when present in a heterozygote Which of the following statements is a correct example of an isolating mechanism A Presence of fertile hybrids B Incompatibility of gametes C Geographical features like a prairie D Hybrid adults have higher evolutionary fitness E Embryos show rapid development Which of the following is not an assumption of the Hardy Weinberg theorem A No evolution B Mating is random C No movement of individuals D No selection or drift E Population sizes are very small Which of the following best describes sexual selection A A process that can lead to the evolution of traits which might not be adaptive B A process that happens between males in competition C A process by which females select males for reproduction D A process where only some individuals are allowed to breed E A process where only some individuals survive Ot for distribution or sale Property of Yo
Biology
Cell Cycle and Cell Division
12 11 owing statements on dominance is correct A The terms dominant and recessive apply to alleles B The terms dominant and recessive apply to genotypes C The dominant allele is the one that is selected for D The dominant allele is the most common in the population E The recessive allele expresses its phenotype even when present in a heterozygote Which of the following statements is a correct example of an isolating mechanism A Presence of fertile hybrids B Incompatibility of gametes C Geographical features like a prairie D Hybrid adults have higher evolutionary fitness E Embryos show rapid development Which of the following is not an assumption of the Hardy Weinberg theorem A No evolution B Mating is random C No movement of individuals D No selection or drift E Population sizes are very small Which of the following best describes sexual selection A A process that can lead to the evolution of traits which might not be adaptive B A process that happens between males in competition C A process by which females select males for reproduction D A process where only some individuals are allowed to breed E A process where only some individuals survive Ot for distribution or sale Property of Yo
A person in your microbiology study group asks you to explain the difference between a lytic virus cycle and a lysogenic virus cycle You respond by saying During a during a virus cycle the cell is killed as the virus exits however virus cycle the virus integrates into the host cell chromosome provirus and replicates along with the cell lysogenic lytic positive sense negative sense lytic lysogenic negative sense positive sense
Biology
Cell Cycle and Cell Division
A person in your microbiology study group asks you to explain the difference between a lytic virus cycle and a lysogenic virus cycle You respond by saying During a during a virus cycle the cell is killed as the virus exits however virus cycle the virus integrates into the host cell chromosome provirus and replicates along with the cell lysogenic lytic positive sense negative sense lytic lysogenic negative sense positive sense
Which of the following is not a portal of exit for a microbial pathog Wound drainage Skin Vomit
Biology
Cell Cycle and Cell Division
Which of the following is not a portal of exit for a microbial pathog Wound drainage Skin Vomit
The body mass index BMI is used mainly to O determine your overall physical condition assess how height correlates with weight O estimate the health significance of your body weight O determine your body fat percentage
Biology
Cell Cycle and Cell Division
The body mass index BMI is used mainly to O determine your overall physical condition assess how height correlates with weight O estimate the health significance of your body weight O determine your body fat percentage
Where does resonance energy Select one Oa Plastoquinone Photosystem I reacti
Biology
Cell Cycle and Cell Division
Where does resonance energy Select one Oa Plastoquinone Photosystem I reacti
8 Using colored pens or pencils show how 2 chromosomes are passed to two daughter cells O O 8 O
Biology
Cell Cycle and Cell Division
8 Using colored pens or pencils show how 2 chromosomes are passed to two daughter cells O O 8 O
wings A E show stages of mitosis in an plant cell A D B a Which of the drawings A E shows i interphase ii prophase iii metaphase iv anaphase v telophase vi cytokinesis C DNA is replicated chromosomes 2 sister chromatids shorten sister chromatids line up sister chromatids separate new nucleus forms at each end cell contents divided between 2 daughter cells
Biology
Cell Cycle and Cell Division
wings A E show stages of mitosis in an plant cell A D B a Which of the drawings A E shows i interphase ii prophase iii metaphase iv anaphase v telophase vi cytokinesis C DNA is replicated chromosomes 2 sister chromatids shorten sister chromatids line up sister chromatids separate new nucleus forms at each end cell contents divided between 2 daughter cells
1 Label the following diagram of mitosis of an animal cell DES
Biology
Cell Cycle and Cell Division
1 Label the following diagram of mitosis of an animal cell DES
Structure of DNA Question 2 Which of these sequences correctly lists each structure or molecule from largest to smallest Select one Chromosome Gene Nitrogenous Base O Nitrogenous Base Gene Chromosome Gene Chromosome Nitrogenous Base Chromosome Nitrogenous Base Gene
Biology
Cell Cycle and Cell Division
Structure of DNA Question 2 Which of these sequences correctly lists each structure or molecule from largest to smallest Select one Chromosome Gene Nitrogenous Base O Nitrogenous Base Gene Chromosome Gene Chromosome Nitrogenous Base Chromosome Nitrogenous Base Gene
What will happen if you place a turgid plant cell in a hypertonic solution A hypotonic solution 1 it will lose water it will gain water 2 it will lose water nothing 3 nothing it will gain water 4 nothing nothing O 3
Biology
Cell Cycle and Cell Division
What will happen if you place a turgid plant cell in a hypertonic solution A hypotonic solution 1 it will lose water it will gain water 2 it will lose water nothing 3 nothing it will gain water 4 nothing nothing O 3
Determine if the diagram below most likely represents the chromosomes of a cell in meiosis I meiosis II or is impossible to determine Explain the reasoning for your answer 3 marks
Biology
Cell Cycle and Cell Division
Determine if the diagram below most likely represents the chromosomes of a cell in meiosis I meiosis II or is impossible to determine Explain the reasoning for your answer 3 marks
Mitochondria originated from proteobacteria 1 True O2 False
Biology
Cell Cycle and Cell Division
Mitochondria originated from proteobacteria 1 True O2 False
In the epiphyseal plate cartilage grows by pushing the epiphysis away from the diaphysis O from the edges inward Oby pulling the diaphysis toward the epiphysis O in a circular fashion
Biology
Cell Cycle and Cell Division
In the epiphyseal plate cartilage grows by pushing the epiphysis away from the diaphysis O from the edges inward Oby pulling the diaphysis toward the epiphysis O in a circular fashion
Which of the following does NOT specifically support of the endosymbiotic theory for the origins of mitochondria and chloroplasts Mitochondria and chloroplasts have double membranes Mitochondria and chloroplasts have circular genomes Mitochondria and chloroplasts are very common Mitochondria and chloroplasts divide by fission independently of the cell 0000
Biology
Cell Cycle and Cell Division
Which of the following does NOT specifically support of the endosymbiotic theory for the origins of mitochondria and chloroplasts Mitochondria and chloroplasts have double membranes Mitochondria and chloroplasts have circular genomes Mitochondria and chloroplasts are very common Mitochondria and chloroplasts divide by fission independently of the cell 0000
Erobic acterium IND Mitochondrion Modern heterotrophic eukaryote
Biology
Cell Cycle and Cell Division
Erobic acterium IND Mitochondrion Modern heterotrophic eukaryote
O pseudopods O cilia fins flagella
Biology
Cell Cycle and Cell Division
O pseudopods O cilia fins flagella
Question 4 atch the terms on the left to the correct explanation nzymes
Biology
Cell Cycle and Cell Division
Question 4 atch the terms on the left to the correct explanation nzymes
A researcher synthesizes a new molecule called inhibitor X that inhibits the activity of phosphofructokinase PFK the enzyme that phosphorylates fructose 6 phosphate during glycolysis Inhibitor X competes with ATP for binding to the PFK active site The researcher determines that the Michaelis Menten constant Km with respect to ATP is 40 M When 2 M inhibitor X is added to the purified PFK reaction the apparent Km for ATP increases to 48 M Calculate the dissociation constant of the PFK inhibitor complex K
Biology
Cell Cycle and Cell Division
A researcher synthesizes a new molecule called inhibitor X that inhibits the activity of phosphofructokinase PFK the enzyme that phosphorylates fructose 6 phosphate during glycolysis Inhibitor X competes with ATP for binding to the PFK active site The researcher determines that the Michaelis Menten constant Km with respect to ATP is 40 M When 2 M inhibitor X is added to the purified PFK reaction the apparent Km for ATP increases to 48 M Calculate the dissociation constant of the PFK inhibitor complex K
es 2452285 quizzes 5493550 take
Biology
Cell Cycle and Cell Division
es 2452285 quizzes 5493550 take
Which of the following statements is NOT CONSISTENT with Cell Theory Bacteria and Eukaryotic cells divide using different mechanisms Archaea and Bacteria are structurally similar but Archaea are genetically more similar to Eukaryotes Viruses are living organisms All of the above
Biology
Cell Cycle and Cell Division
Which of the following statements is NOT CONSISTENT with Cell Theory Bacteria and Eukaryotic cells divide using different mechanisms Archaea and Bacteria are structurally similar but Archaea are genetically more similar to Eukaryotes Viruses are living organisms All of the above
The cholera toxin produces massive diarrhea and dehydration and possible death if not treated The toxin ultimately affects a chloride channel which is controlled by ATP Activation of the channel results in the efflux of chloride out of the cells of the intestine Sodium follows chloride and water follows producing the diarrhea How is the chloride channel activated Adenosine binds to the chloride channel causing the conformational change and the channel opens ADP binds to the chloride channel causing the conformational change of the channel and the channel opens The channel is dephosphorylated causing the conformational change and the channel opens ATP hydrolyzes producing ADP and Pi The inorganic phosphate causes a conformational change and the channel opens
Biology
Cell Cycle and Cell Division
The cholera toxin produces massive diarrhea and dehydration and possible death if not treated The toxin ultimately affects a chloride channel which is controlled by ATP Activation of the channel results in the efflux of chloride out of the cells of the intestine Sodium follows chloride and water follows producing the diarrhea How is the chloride channel activated Adenosine binds to the chloride channel causing the conformational change and the channel opens ADP binds to the chloride channel causing the conformational change of the channel and the channel opens The channel is dephosphorylated causing the conformational change and the channel opens ATP hydrolyzes producing ADP and Pi The inorganic phosphate causes a conformational change and the channel opens
QUESTION 7 What is the fate of the pyruv O Pyruvate combines with O Pyruvate is reduced to ei O Pyruvate travels to the el
Biology
Cell Cycle and Cell Division
QUESTION 7 What is the fate of the pyruv O Pyruvate combines with O Pyruvate is reduced to ei O Pyruvate travels to the el
7 List the nitrogenous base pairings in DNA always pairs with joined by joined by always pairs with bonds bonds
Biology
Cell Cycle and Cell Division
7 List the nitrogenous base pairings in DNA always pairs with joined by joined by always pairs with bonds bonds
To what category does this amino acid belong Note that the non ionized form is shown H N C C H C OH CH3 H H Opolar uncharged polar negatively charged non polar Opolar positively charged O OH
Biology
Cell Cycle and Cell Division
To what category does this amino acid belong Note that the non ionized form is shown H N C C H C OH CH3 H H Opolar uncharged polar negatively charged non polar Opolar positively charged O OH
Insolation 90 75 60 45 30 15 0 15 30 45 60 75 90 Latitude S Equator Latitude N What month do you think this graph represents a December b March c June d September
Biology
Cell Cycle and Cell Division
Insolation 90 75 60 45 30 15 0 15 30 45 60 75 90 Latitude S Equator Latitude N What month do you think this graph represents a December b March c June d September
What makes a carb or any other molecule an isomer of another molecule and how does that influence the molecules function
Biology
Cell Cycle and Cell Division
What makes a carb or any other molecule an isomer of another molecule and how does that influence the molecules function
ATGACGGATCAGCCTCAATACGAATT 1 Write the sequence of the mRNA for Mutant 1 2 Write the sequence of the DNA template stran 3 Write the amino acid sequence of the polypept 4 Write the sequence of the DNA coding strand
Biology
Cell Cycle and Cell Division
ATGACGGATCAGCCTCAATACGAATT 1 Write the sequence of the mRNA for Mutant 1 2 Write the sequence of the DNA template stran 3 Write the amino acid sequence of the polypept 4 Write the sequence of the DNA coding strand
PROBLEM IV Consider the following karyotype of a specific animal The homologous pairs are grouped together in the picture CHR 30 110 7 18625 THI 3063 D X 95 SH 1 What is the ploidy number of the corresponding cell 2 How many somatic chromosomes are there in this cell 20 3 How many chromosomes are there in a haploid cell of the animal 4 How many chromatids are there in the top row of chromosomes of this karyotype 5 How many chromatids are there in the top row of chromosomes 6 How many sister chromatids are there in the top row of chromosomes 7 How many non sister chromatids are there in the top row of chromosomes 8 This karyotype has been obtained from sperm cells egg before fertilization a male som female somatic cell This karyotype shows chromosomes in which phase of the cell cycle
Biology
Cell Cycle and Cell Division
PROBLEM IV Consider the following karyotype of a specific animal The homologous pairs are grouped together in the picture CHR 30 110 7 18625 THI 3063 D X 95 SH 1 What is the ploidy number of the corresponding cell 2 How many somatic chromosomes are there in this cell 20 3 How many chromosomes are there in a haploid cell of the animal 4 How many chromatids are there in the top row of chromosomes of this karyotype 5 How many chromatids are there in the top row of chromosomes 6 How many sister chromatids are there in the top row of chromosomes 7 How many non sister chromatids are there in the top row of chromosomes 8 This karyotype has been obtained from sperm cells egg before fertilization a male som female somatic cell This karyotype shows chromosomes in which phase of the cell cycle
O Which types of bridges are present in the protein insulin a tripeptide Ob trisulfide O c dipeptide d disulfide e polypeptide
Biology
Cell Cycle and Cell Division
O Which types of bridges are present in the protein insulin a tripeptide Ob trisulfide O c dipeptide d disulfide e polypeptide
UESTION 11 ch the description to the component Also called actin filaments Used to help the movement of organelle cell Assist with cell movement associated wi
Biology
Cell Cycle and Cell Division
UESTION 11 ch the description to the component Also called actin filaments Used to help the movement of organelle cell Assist with cell movement associated wi
What is the name of the weak Is this a strong or weak bond What is the name of the bond that holds amino acids together Is this a strong or weak bond
Biology
Cell Cycle and Cell Division
What is the name of the weak Is this a strong or weak bond What is the name of the bond that holds amino acids together Is this a strong or weak bond
4 Relate DNA replication to how accurate genetic information is passed down through generations a Explain how DNA replication ensures that genetic information is conserved when a parent cell divides by mitosis 2 points
Biology
Cell Cycle and Cell Division
4 Relate DNA replication to how accurate genetic information is passed down through generations a Explain how DNA replication ensures that genetic information is conserved when a parent cell divides by mitosis 2 points