22 Referring to the genetic code presented in Figure 15 10

Last updated: 5/13/2023

22 Referring to the genetic code presented in Figure 15 10 give the amino acids specified by the following bacterial mRNA sequences a 5 AUGUUUAAAUUUAAAUUUUGA 3 b 5 AGGGAAAUCAGAUGUAUAUAUAUAUAUGA 3 c 5 UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA 3 d 5 GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUUUUGA 3