The Living World Questions and Answers

Biology
The Living WorldPredict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response

Biology
The Living WorldDNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5

Biology
The Living WorldA bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population

Biology
The Living WorldYou are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an autosomal trait that shows a recessive expression pattern What is the frequency of the deleterious harmful allele in the population 2 20 80 4

Biology
The Living WorldIn the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways the population is diploid the population is doubling in number

Biology
The Living WorldThe tRNA nucleotide sequence that pairs with bases on the mRNA is called a n intron O exon O codon O initiation factor Q anticodon QUESTION 40 When a polypeptide is being assembled the bond that forms between a newly added amino acid and the previous amino acid in the chaim a bond O hydrogen O hydrophobic O terminal O phosphodiester

Biology
The Living WorldAn organism has been found to contain a defective form of photolyase What function might be impaired in this organism r Lengthening of the tips of chromosomes Repair of DNA damage caused by UV light Stabilization of single stranded DNA during DNA replication Recognition of damaged DNA by the UvrABC complex QUESTION 26 The sequence of nucleotides in a DNA molecule is called the O protein ribosomal translation genetic amino acid code




Biology
The Living WorldWhich term describes an organism that cannot survive in the presence of oxygen obligate aerobe O obligate anaerobe O pathogen facultative aerobe 1F

Biology
The Living WorldWhich statement is true about all members of Domain Eubacteria and Domain Archaea 1 point O They are multicellular organisms prokaryotes and contain membrane bound organelles They are multicellular organisms eukaryotes and lack membrane bound organelles O They are single celled organisms prokaryotes and contain membrane bound organelles They are single celled organisms prokaryotes and lack membrane bound organelles

Biology
The Living WorldWhich statement s is are true about prokaryotes The total mass of prokaryotes exceeds that of animals and possible all plant life on Earth More than 100 trillion bacteria live on and within our bodies 1 point They live in a variety of environments including on the surface of other organisms in water and soil deep within Earth in boiling hot springs and in ice All of the above

Biology
The Living WorldWhich animal is classified in the Arthropoda phylum pinworms earthworms snails insects

Biology
The Living WorldWhich term describes a form of asexual reproduction that involves the division of one parent cell into two genetically identical daughter cells Otransformation conjugation binary fission fermentation

Biology
The Living WorldWhich term describes a corkscrew shaped bacterial cell O spirillum O pathogen O bacillus O COCCUS

Biology
The Living WorldWhat type of cell contains half the usual complement of chromosomes zygote O haploid O diploid all of the above

Biology
The Living WorldWhich statement is true about the domains of living things Kingdom Bacteria and Kingdom Archaea are in the same domain Domain Eucaryotes includes only Kingdom Protista Domain Bacteria includes Kingdom Archaea and Kingdom Protista Four kingdoms are classified into the Domain Eukaryote


Biology
The Living WorldWhich term describes a single celled organism that contains membrane bound organelles O autotroph O eukaryote heterotroph Oprokaryote

Biology
The Living WorldIn Linnaeus s binomial naming system the second name is always what O the specific name O the genus name the clade name the kingdom name

Biology
The Living WorldWhich of the following is an example of an autotroph tree O dog bird elephant

Biology
The Living WorldHow does loss of biodiversity affect humans It threatens our food supply O It has a significant economic impact on tourism and forestry O It eliminates sources of natural medicines O all of the above

Biology
The Living World1 Create a brochure over an infectious disease that can be distributed in a healthcare facility The brochure should be professional and informative You may choose your own microbe After signing into Canva you can search brochure in the search bar for options You may also create the artifact using a blank template Be sure to include pictures or graphics where applicable nclude the following in your brochure The infectious disease and the causative agent the microbe Mode of transmission Signs Symptoms

Biology
The Living Worldon 1 A an occurs when the receiving team successfully puts the ball away against the serving team or when the serving team commits an unforced error and the receiving team thus gains the right to serve point O attack service error Points 2 O side out

Biology
The Living WorldFruits have contributed to the success of angiosperms by nourishing the plants that make them facilitating the dispersal of seeds attracting insects to the pollen inside producing sperm and egg inside a protective coat producing trippid cells via double fertilization

Biology
The Living WorldYou have now learned about pollination and fertilization in the flowering plants It is important to remember what these two processes are and how they occur Which of the following is the correct order of events sperm cells form in anthers pollination occurs the pollen tube reaches the ovule the egg is fertilized the stigma is fertilized the sperm cells develop the pollen tube reaches the ovule the sperm cells reach the egg the stigma is pollinated the pollen germinates double fertilization occurs the seed begins to develop pollen is produced the pollen is distributed to the stigma the pollen tube grows to the ovule the sperm cells are produced

Biology
The Living WorldThe seeds of a flowering plant consist of a n Select Select tissue endosperm The seed coat is Select em

Biology
The Living WorldYou find a plant you have never seen before and notice the flowers are relatively small lack any odor and are relatively colorless The flower is most likely pollinated by flies hummingbirds bees the wind

Biology
The Living WorldWhich of the following is true of fruits Select all that apply They are seed bearing They provide nutrition to the developing seeds They facilitate the dispersal of seeds All fruits have evolved to attract animals 4

Biology
The Living WorldMonoecious Black Walnut trees are a common tree in Central Pennsylvania their nuts are an important source of food for wildlife They flower in the spring This photo shows those flowers male and female lowers are found on the same tree Choose all of the terms below that apply to this plant Dioecious Synoecious Female flower Perfect flowers Male flower Imperfect flowers

Biology
The Living WorldQuestion 7 In seed plants the gametophyte plants 0 5 generation is more reduced than in seedless

Biology
The Living WorldWhat are the NACE competencies Give me your idea about them and how they work for you

Biology
The Living WorldWhat are the NACE competencies Give me your idea about them and how they work for you

Biology
The Living WorldWrite a conclusion about emotional intelligence Clifton strengths and NACE competencies and what is the best selfrefection about them

Biology
The Living Worldglucose and lactose lactose glucose Question 27 ISP O Z Y A repressor can t bind allolactose glucose lactose alunnee Choose Choose Choose Choose Choose

Biology
The Living WorldAmino acid residues 1 through 13 of the spike protein constitute its signal peptide The signal peptide s sequence is H N MFVFLVLLPLVSS coo What is the overall nature of the signal peptide It s positively charged It s hydrophobic It s negatively charged O It s hydrophilic but uncharged

Biology
The Living WorldYou have generated several random mutations in this region One of them is 5 AAUUACCUAUAGAUUGUUU 3 What may be the mutant protein sequence Enter the single letter code for the amino acids For a stop codon if any enter STOP And fill subsequent blanks with N A For example if you the sequence you need to enter is M enter M N A N A N A N A

Biology
The Living WorldSARS C The Delta Variant of SARS COV2 sequence of the same region is 5 AAUUACCGGUAUAGAUUGUUU 3 What is the mutant protein sequence O H3N NYLYRLF coo H3N NYRYRLF coo H3N ID NTKN W coo H3N FLRYRYN coo H N NY YRLF coo H3N FLRYLYN coo H N FVLYVH coo

Biology
The Living WorldSARS B SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The original Wuhan isolate of SARS CoV2 RNA sequence of the spike protein includes the following segment 5 AAUUACCUGUAUAGAUUGUUU 3 What is the protein sequence encoded here The protein region encoded by this segment is at the top of the receptor binding domain of the spike protein and is shown as a yellow circle in the figure in Question SARS A H3N IDK coo H3N NYLYRLF coo H3N FLRYLYN coo

Biology
The Living Worldglucose 6 phosphatase catalase Ophospholipase C Question 30 1 point Listen Saved Which of the following organelles produces and modifies polysaccharides that will be secreted by a eukaryotic cell O lysosome O mitochondrion peroxisome

Biology
The Living Worldpolarizing repolarizing hyperpolarizing threshold Question 26 1 point Saved Listen Dynamic assembly and disassembly of a cytoplasmic microtubule in a cell occurs primarily at its plus end because its minus end is usually anchored to a mitochondrial outer membrane the plasma membrane a microtubule organizing center

Biology
The Living WorldActin filaments may form each of the following except filament networks O contractile bundles Obranched networks central shaft of flo

Biology
The Living Worldglia the myelin sheath nodes of Ranvier synaptic boutons minate at structures called Question 41 1 point 1 Listen Each of the following is true about Ras except O Ras activity is inhibited by GTPase activating proteins GAPs Ras binds steroid hormones O Ras is monomeric coll

Biology
The Living WorldThe technique that can be used to record ion currents passing through individual channels is known as ligand gating voltage gating patch clamping optogenetics

Biology
The Living WorldAn example of a generally inhibitory neurotransmitter is GABA O glutamate O acetylcholine

Biology
The Living WorldKinase enzymes always inhibit target molecule activity add phosphate groups O bind tightly by wrapping around a target molecule to regulate its activity remove phosphate groups

Biology
The Living WorldEach of the following is a type of glial cells except Platelets oligodendrocytes astrocytes von

Biology
The Living WorldEach of the following is an intracellular messenger except IP3 calcium ions O CAMP acetylcholine

Biology
The Living WorldThe phase at the end of an action potential when the membrane potential becomes more negative than it is at rest is the phase depolarizing Orepolarizing