3 Given the guiding region of a single guide RNA sgRNA and

Last updated: 4/28/2023

3 Given the guiding region of a single guide RNA sgRNA and the double stranded DNA dsDNA in the following picture Guiding region AACGGGCGCUGGGUCGGUUA Target dsDNA TGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAG ACCACGTTGCCCGCGACCCAGCCAATGCCGGTCCTGTC a Highlight the sequence in the target dsDNA which is specifically recognized by the sgRNA b In the dsDNA indicate the region where Cas9 would cut the target dsDNA 45 X bi lactose X y plasmid ot 0 1 1 10 lac 2 of mutation