Question:
An undergraduate student obtained the DNA sequence shown
Last updated: 1/30/2023
![An undergraduate student obtained the DNA sequence shown](https://media.kunduz.com/media/sug-question-candidate/20230130182157160738-4376984.jpg?h=512)
An undergraduate student obtained the DNA sequence shown below as part of a work study project in a lab Based on this DNA sequence how many ORFs does it possibly encode Explain your reasoning Write down the predicted protein sequence s 3 marks 3 5 ATATGTACGGTCATATTTACCCATAACTATT TATCATGCCAGTATAAATGGGTATTGATAA 5 3