Question:
ATGACGGATCAGCCTCAATACGAATTGGCGTTTAAGGCGGATGCGCCGTAA 1 Write
Last updated: 2/18/2023

ATGACGGATCAGCCTCAATACGAATTGGCGTTTAAGGCGGATGCGCCGTAA 1 Write the sequence of the mRNA for the Mutant 3 strain 2 Write the amino acid sequence of the polypeptide that corresponds to the Mutant 3 strain 3 Calling the following mutant Mutant 4 Write the sequence of the DNA coding strand from a transversion nonsense mutation affecting the seventh 7th codon 4 Write the sequence of the DNA template strand for the Mutant 4 strain 5 Write the sequence of the mRNA for the Mutant 4 strain 6 Write the amino acid sequence of the polypeptide that corresponds to the Mutant 4 strain 7 How many possible open reading frames can you identify in the mRNA sequence or coding DNA sequence of the Mutant 4 strain