Consider the following DNA molecule Assume this is the DNA

Last updated: 1/30/2023

Consider the following DNA molecule Assume this is the DNA sequence of an entire chromosomes After replication what will be the sequence of its sister chromatid Explain the reasoning for your answer 4 marks 5 ATATGTACGGTCTTATTTACCCATACCTATT 3 5 3 TATCATGCCAGAATAAATGGGTATGGATAA