Recall that sgRNAs for CRISPR Cas9 have a 20 nt sequence
Last updated: 5/13/2023

Recall that sgRNAs for CRISPR Cas9 have a 20 nt sequence that is identical or nearly identical to a 20 bp sequence in the genome you want to modify Recall also that for Cas to cleave the DNA that 20 bp sequence must be followed immediately in the genomic DNA by the sequence 5 NGG which is called a PAM site Cas9 then cleaves both strands of DNA between the bases 3 and 4 bp upstream of 5 to the PAM site You are designing an sgRNA that will bring Cas9 protein to the following site in genomic DNA where you want to correct a disease allele by knocking in a wild type allele 3 5 TTCGCGTAAATTCGTCGTAACTCTAGGTG 3 AAGCGCATTTAAGCAGCATTGAGATCCAC 5 Which of the 20 nt sgRNA sequences shown will work Multiple Choice OS AUUCGUCGUAACUCUAGGUG 3 OS UUCGCGUAAAUUCGUCGUAA3 5 CGUAAAUUCGUCGUAACUCU 3 O 3 GCAUUUAAGCAGCAUUGAGA S