Question:
The mutant coding DNA strand 5
Last updated: 7/31/2023
The mutant coding DNA strand 5 GGCCATGACAGAGGAGAAAAAGTTATTGCT 3 Write the mRNA sequence for this patient Write it 5 to 3 but only include the letters in the sequence ex ACGG in your answer Type your answer and submit 22 X X 5 CCGGUACUGUCUCCUCUUUUUUCAAUAACGAC 3 Hint coquence X