The sequence below represents the coding strand also called
Last updated: 4/28/2023
![The sequence below represents the coding strand also called](https://media.kunduz.com/media/sug-question-candidate/20230428004227945944-3610613.jpg?h=512)
The sequence below represents the coding strand also called the nontemplate strand of a gene from a rapidly mutating virus starting with the sequence that encodes the translation initiation codon 5 ATGGCGACTATCGTTAAGTA 3 You have isolated a mutant version of this gene that contains three base pair changes underlined below 5 ATGGCCACTATAGTTTAGTA 3 This combination of mutations will result in Codon table for reference First Letter U G U UUU UCU UUC UCC UUA UCA UUG UCG CUU CCU CUC CCC CUA CCA CUG CCG AUU ACU AUC lle ACC AUA ACA AUG Met Start ACG GUU GCU GCC GCA GCG GUC GUA GUG Phe Leu Leu Val C Second Letter Ser Pro Thr Ala A UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu G UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly MCACU O ADO A U Third Letter A substitution of only one amino acid in the polypeptide product OB substitution of multiple amino acids in the polypeptide product OC a shorter mRNA transcript OD a shorter polypeptide product