Question:
When mRNA is translated, each of the codons below codes for
Last updated: 7/9/2022
![When mRNA is translated, each of the codons below codes for](https://media.kunduz.com/media/sug-question/raw/53466892-1657376508.978925.jpeg?h=512)
When mRNA is translated, each of the codons below codes for serine. • UCU • UCC • UCG • UCA When translated, which of the following DNA sequences would lead to a serine amino acid in the peptide. ATGGGTCAAATCGTGTACTGA ATGGGTCTAATCGGGTTCTGA ATGCGTCAAAACGTCTACTGA ATGGGTCAAAGCGTGTCCTGA