Question:
0 21 The original DNA mutates to form the following strand
Last updated: 12/17/2023
![0 21 The original DNA mutates to form the following strand](https://media.kunduz.com/media/sug-question-candidate/20231217172126270282-3667276.jpg?h=512)
0 21 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGGCCCGCACAAUAGUUGC 3 Translate this sequence What type of mutation is this
Last updated: 12/17/2023
0 21 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGGCCCGCACAAUAGUUGC 3 Translate this sequence What type of mutation is this