Molecular Basis of Inheritance Questions and Answers

Mendel used the garden Olily carrot onion pea plant for his studies on inheritance QUESTION 48 In modern terminology Mendel s heredity factors are called O DNA O chromosomes O genes ORNA

QUESTION 49 Traits that are controlled by genes located on the X chromosome are said to be O autosomal O gametal O sex linked Opleiotropic QUESTION 50 The lagging strand is replicated with a series of Okazaki fragments and that is why its synthesis is considered to be O discontinuous O continuous O bidirectional O antiparallel Osemiconservative

Which base in an anticodon will pair with the base adenine in a codon O thymine O cytosine O guanine Ouracil QUESTION 34 A codon is composed of how many bases O one O two Othree O four GA

During translation amino acids are carried to the ribosome by O mRNA O tRNA O snRNA O rRNA O miRNA QUESTION 32 RNA polymerase synthesizes a molecule of RNA using DNA as a template During O mRNA splicing Otranslation O transcription O gene sequencing

Xeroderma pigmentosum XP is a rare autosomal recessive disorder Patients with XP exhibit a cellular hypersensitivity to ultraviolet UV radiation a high incidence of skin cancer and premature aging Based on these clinical characteristics what is the most likely cause for this disease defects in DNA repair defects in DNA replication lack of telomerase activity shortened telomeres QUESTION 22 If a mutation produced helicase that was unable to hydrolyze ATP DNA replication would be stopped speeded up unaffected more prone to errors

The site where the two original DNA strands separate and active replication occurs is called the O replication fork replisome primosome lagging strand sliding clamp subunit QUESTION 14 During replication which enzyme unwinds the DNA double helix O DNA primase O DNA polymerase I DNA helicase DNA gyrase O DNA ligase

QUESTION 5 Information obtained by Franklin from X ray crystallography on DNA suggested that it is shaped like a O helix O ribbon O hollow cylinder O pleated sheet O icosahedron QUESTION 6 In DNA complementary nitrogen bases are held together by bonds O hydrogen bonds O hydrophobic bonds O peptide bonds

Where along the parent DNA strand does synthesis of the new DNA strand take place Select one a O b Forks are used to pop the replication bubbles O d Outside of the replication bubbles OC At the forks of the replication bubbles Only in areas were the DNA is zipped up

chromosome Some useful information orf is the origin of replication strand A and strand B are referring to the template strands for replication to the right of the origin of replication you ll have to use your imagination to picture the soon to be replicated new strands ori strand A strand B For each question below select from the options in A through D and the explain A if the word or phrase is associated with strand A only B if the word or phrase is associated with strand B only Bio285 F23 C if the word or phrase is associated with strand A and B D if the word or phrase is associated with neither strand A nor B Topic 9 Problem Set 1 Replication of this strand involves a single primer molecule ii Replication of this strand involves several primer molecules 3 end 15 end ui Replication of this strand does not need primer Francis

E When the primer in the middle is removed and filled in with DNA the fragments mu then be joined i Which type of enzyme fills in the DNA after the primer has been removed Explain A DNA polymerase fills in the DNA after the primer has been removed

Which of the following does not affect the amount of a certain protein synthesized in prokaryotic cells Mark the correct answer s mRNA processing Use of alternative sigma factors binding of repressors to operator sequences Transcription regulation Stabilization of the mRNA Inhibition of translation with miRNAs

Match the following mutations with the correct designation of its type i e dominant or recessive N 2 1 d 69 S Is Choose Choose Choose recessive dominant ICH V

1 2 3 tus Signals beginning Signals end 4 5 6 7 8 9 10 11 12 11 Translation Transports amino acids 9 Complements codon 10 A Termination sequence B AUG C Ribosome D Template strand E mRNA F Coding strand G Anticodon H Polypeptide 1 Promoter J Codon K UGA UAA UAG Takes place 7 End product 8

Match the RNA function with the correct type of RNA Carries the message of DNA into the cytoplasm for ribosomal A rRNA processing B SRP RNA C snRNA D tRNA E Small RNA F mRNA Multiple types found in ribosomal subunits Carries amino acids to ribosomes to make proteins Processes pre mRNA Contains both protein and RNA found within RER Y Control of gene expression

Match the mutation with its most appropriate correct description If a portion of a chromosome is broken off and joined to another chromosome If a region of a chromosome is replicated within a chromosome When a portion of a chromosome is broken off then turned around and put back into the chromosome A nonsynonymous mutation that changes the required amino acid When a mutation changes a sequence of amino acids that are regular to a stop codon When the reading of bases is added to or reduced and changes the reading of correct amino acid sequences When a sequence of DNA is replicated three times found in Huntington s disease A Inversion B Translocation C Frameshift D Nonsense E Duplication F Triplet repeat expansion G Missense

1 What is the mode of inheritance in the pedigree chart above Dominant TO Recessive Codominance 80 166 I II III IV Carrier Incomplete dominance 2 What is the mode of inheritance in the pedigree chart above Carrier Sex Linked Incomplete Dominance KEY Does not have condition Has condition Carrier Multiple Alleles B Complete the following exercise 1 Make a concept map showing the different types of inheritance analyses

A researcher extracts the cytosol and cytoskeletal components from the cell and places the mixture into a tube What result do you expect if the researcher adds a nonhydrolyzable GTP analog to the mixture in vitro O overstabilization of all polymerized microtubules present in the tube destabilization of all polymerized microfilaments present in the tube overstabilization of all polymerized microfilaments present in the tube O destabilization of all polymerized microtubules present in the tube

2 Write the CODON that corresponds with each amino acid There may be more than one The full names are written but the codon chart only shows the first three letters proline valine histidine 3 A single codon is used to signal the beginning of protein synthesis It is commonly called the START CODON Locate the start codon on the chart What are the three bases of this codon 4 There are three codons that signal the end of synthesis these are called STOP codons What are the three stop codons 5 For each sequence of DNA is shown Write the complementary RNA sequence underneath the letters then use the codon chart to determine the amino acid sequence NATAC CAT GGA ATT ACT RNA Amino Acids glycine phenylalanine arginine DNA RNA Amino Acids TTC AAT GGT CTA GGG

step in this process is called TRANSCRIPTION where a coding region of DNA is converted to messenger RNA mRNA During transcription mRNA is made from the DNA sequence following the base pair rule except RNA does not contain the base Thymine but instead has Uracil The mRNA then leaves the nucleus and goes to a ribosome in the cell s cytoplasm The ribosome reads the message three bases at a time called a CODON Each codon will specify a single amino acid The amino acids are joined together and folded into a protein a process called TRANSLATION Key Points DNA is used to make a copy of mRNA transcription mRNA leaves the nucleus and goes to ribosomes 3 bases codon 1 codon a single amino acid A chain of amino acids a protein Protein synthesis is also called translation Biologists use a codon chart or a codon wheel to determine the amino acids Amino acids are usually abbreviated on these charts as three letter words like Cys and Ser First base in codon U C G UUU UUC UUA UUG CUU CUC CUA CUG AUU UCU UCC UCA UCG CCU CCC CCA CCG ACU AUC lle ACC AUA ACA AUG ACG GUU GCU GUC GCC GUA GCA GUG GCG Phe Leu Leu Met of start Second base in codon C A Val Ser Pro Thr Ala UAU U UAC Tyr C UAA Stop UGA Stop A UAG Stop UGG Trp G CGU CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG His Gin Asn Lys UGU UGC Asp Glu Cys 3 CGC CGA CGG AGU AGC AGA AGG Arg GGU GGC GGA GGG Arg Ser Gly C GUCAG U A G Third base in codon Val Ala Ser G 10 G Arg A Lys Asp A 24 OP GU Asn A Cu Glu UC U C G Gly Phe Leu UA U G C G C Thr GA A A Met Start CU C GU GU A C UG 110 2 PO UA GACGC C 2 A Arg C A A A G C Ser G 2 U 15 UC Gin 2109342 Tyr His PG SONA C So UC G Stop Stop G Trp Stop Cys Pro Leu

5 Mendel s Laws 5 3 Define Mendel s two laws How do we use probability rules to predict the results of genetic crosses 6 Pedigrees 5 3 Diagram simple pedigrees for a dominant trait a recessive trait and a sex linked recessive trait Label with appropriate genotypes 7 Punnett Squares 5 3 Draw Punnett squares for a monohybrid cross a sex linked cross and a dihybrid cross Give the expected phenotype and genotype ratios for each 8 Non Mendelian Genetics 5 4 Not all traits follow Mendelian patterns Explain how this statement applies to a degrees of dominance b multi gene traits c mitochondria and chloroplasts 9 Environmental Effects 5 5 Give an example of how the environment can influence phenotype Define plasticity Pg 56 10 Genetic Disorders 5 6 Make a chart of 3 human genetic disorders their symptoms and their causes Pg 11 Chi Square Analysis Science Practice 5 Statistical Tests and Data Analysis Show an example of a chi square analysis and answer the following questions How is a chi square test carried out What do its results tell you When do you accept the null hypothesis When do you reject it What types of data are suitable for chi square analysis Total 2 5 5 5 5 2 5 5 5 5

Provide the abbreviation of the following nucleotide 01 07 OH OH MP NH d AG C TU DR TR NH

View Available Hint s U G C A 3 5 DNA coding information strand G1 U DNA template strand G1 G1 Synthesis of mRNA G2 G2 T Transcription bubble G2 G2 G G2 RNA polymerase ACT G2 G2 G1 G2 Termination site Reset Help

First step of transcription RNA polymerase identifies the termination sequence mRNA strand and RNA polymerase are released The correct ranking cannot be determined Submit Previous Answers RNA polymerase identifies the start sequence DNA double helix unwinds to expose the nucleotide bases Last step of transcription RNA polymerase adds bases that are complementary to the DNA template Incorrect Try Again 2 attempts remaining The mRNA is the end product of transcription To synthesize the mRNA strand the DNA should unwind to expose the nucleotides and then the enzyme RNA polymerase recognizes and connects with the control segment in DNA to be tr The mRNA is assembled as the RNA polymerase moves down the DNA template adding complementary nucleotides to the growing RNA strand Transcription ends when the RNA polymerase reaches a termination sequence and the ne

Arrange the steps of transcription of DNA to synthesize mRNA Rank the steps of transcription View Available Hint s of DNA to synthesize mRNA To rank items as equivalent overlap them RNA polymerase identifies the start sequence First step of transcription DNA double helix unwinds to expose the nucleotide bases mRNA strand and RNA polymerase are released RNA polymerase identifies the termination sequence RNA polymerase adds bases that are complementary to the DNA template Reset He Last step of transcription

Which of the following genotypes causes Jacobs syndrome O XO XXX O XXY OXYY

the space provided 18 I List in the correct order all of the signals needed during translation to make this transmembrane protein It will not be part of the mitochondrion or chloroplast Use the names of the signals bes olozsv m ng NH COOH CYTOSOL ER LUMEN botalamon riendly Has the ER signal sequence been removed

4 The ruffed chicken has an under chin wattle A smooth wattle S is dominant over a wrinkled wattle s A red wattle HR is incompletely dominant with a white wattle HW so that an individual with HRHW will have a pink wattle A chicken with a wrinkled red wattle is mated to a homozygous chicken with a smooth white wattle What is the genotype and phenotype of the chicks 4 points

3 Pigment in mouse fur is only produced when the C allele is present Individuals of the cc genotype are white If color is present it may be determined by the A a alleles AA or Aa results in agouti color while aa results in black coats What F and F phenotypic ratios are obtained from a cross between AACC and aacc mice What phenomenon is demonstrated in this problem 4 points

6 A paternity case has been filed by a mother with type B blood who has a child with type O blood One potential father has type AB blood another has type A blood both his parents were AB and the third potential father has type A blood one of his parents had AB and one of his parents had A blood Based on this information which man is most likely to be the father 3 points

III O III ON O O ll II SOOSSAS IV H The figure represents a tRNA molecule that recognizes and binds a particular amino acid but it has the same general structu as all other tRNAs Which of the regions labeled in roman numerals I through V corresponds to the anticodon loop V

1 Diabetes has been found to be inherited in many cases through a recessive allele d Two parents who are non diabetic have a diabetic child Write the genotypes of all three persons 2 In corn there are two alleles for the gene for sugar content High sugar content su is recessive to low sugar content Su Give the phenotypes for each of the following individuals Susu susu SuSu 3 Skin color in a fish is inherited via a single gene with four different alleles How many different genotypes would be possible in this system List them 4 Achondroplasia a form of dwarfism is inherited as a dominant condition Two dwarfs both of whom had one parent of normal height marry and plan to a have child Their first child is born and is a dwarf What is the probability that this child is heterozygous

2 How does a geneticist use pedigrees to create genetic crosses to trace the inheritance of traits over generations of families to prove that sex linked traits are caused by codominant allel Oto replicate identical strings of DNA

Why do histones bind tightly to DNA Histones are negatively charged and DNA is positively charged Both histones and DNA are strongly hydrophobic Histones are covalently linked to the DNA Histones are positively charged and DNA is negatively charged

DNA replication is Osemiconservative O conservative Odispersive irregular

3 Describe in what way are changing gene expression affects overall protein levels in the cell and what processes in the expression of genes eventually influence the amounts of proteins

O miRNA Histone modification factors Question 3 Methylation is involved with DNA that does not have coding regions O True O False 10 pts Question 4 20 pts

Question 5 What is DNA methylation Modifications that control DNA transcription typically due to environmental factors 20 pts Recent mutations inherited in the DNA Genomic regions that control the expression of distal genes O Modifications of the N terminal tails of histones during translation

GUU GCU GUC GCC GUA Val GCA Ala GUG GCG GAU GAC GAA GAG AUG Met or Start UAG UAA and UGA Stop Asp Glu This is the normal messenger RNA for MC1R in dogs is Glu Ser Phe Lys Asp Arg protein is too short Ser Gln Glu Leu Arg Lys protein is too long Glu Ser Phe Lys Asp Arg protein is too long GGU GGC GGA GGG Yellow Labrador Retrievers produce this mRNA transcript Gly 5 AGCCAGGAACUUCGAAAG 3 Dept Biol Penn State C2002 5 AGCCAGGAACUUUGAAAG 3 UCAO What is the normal sequence of the polypeptide that is produced and what type of mutation is seen in yellow labs

Rifamycin is an antibiotic used to treat the bacterium that causes tuberculosis It works by binding to the bacterium s RNA polymerase subunit This kills the bacterium by inhibiting transcription translation DNA replication cell division 13

Which characteristic of the genetic code lowers the likelihood of a mutation causing a m phenotype Universality Un ambiguity Non overlapping N

During the process of transcription DNA polymerase adds nucleotides to the newly synthesized strand one DNA strand serves as a template a supply of the nucleotides ACGT is required two new RNA molecules are produced

Which of the following sets of tRNA anticodons would associate with the following mRNA c translation 5 TTA GGT AAA 3 5 UUA GGU AAA 3 5 AAA TGG ATT 3 O5 AAA UGG AUU 3 5 AAU CCA UUU 3

AUG Met or Start UAG UAA and UGA Stop Dept Biol Penn State 2002 The genetic disease sickle cell anemia is due to a mutation in the B globin gene a component of hemoglobin Normal B globin allele template strand 3 TGAGGACTCCTC5 Sickle B globin allele template strand 3 T GAGGACACCTC 5 Which of the following statements best summarizes the sickle cell mutation This is a silent mutation The mutation results in a Leu being replaced by a His O The mutation results in a Glu being replaced by a Val The mutation results in a stop codon appearing in the mRNA too early

Mutation questions Transcribe then translate this normal sequence of DNA all questions below will refer to this sequence 5 GGTATGGCCGCACAATAGTTGC 3 3 CCATACCGGCGTGTTATCAACG 5 I 18 19 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCAUAAUAGUUGC 3 Translate this sequence

5 1 2 4 3 Date What kind of gametes does a person of genotype AaBb produce What kind of gametes does a person of genotype DdEE produce Brown hair is dominant over blonde hair Using the letters B and b write the genotype for the following persons a homozygous brown b heterozygous brown c homozygous blonde A brown eyed man Bb marries a brown eyed woman Bb Blue eyes are recessive a Give the genotypic ratios of the children b Give the phenotypic ratios of the children Hour Two non freckled parents Ff are crossed What proportion of their children could be freckled A brown eyed man Bb or BB married a blue eyed woman bb Their first child is blue eyed What is the man s genotype Explain

Which of the following choices is the method we used to evaluate the effect of UV light exposure on E coli and B subtilis in the lab We divided one NA plate in half and swabbed one culture per side Then exposed it to the UV light We divided one NA plate in half swabbed the entire surface of the agar using the inoculum from a pure culture and exposed only one side to the UV light We turned on the UV light and let the plates sit in the cabinet with lids on We turned on the UV light and let the exposed swabbed areas under the light for different amounts of time True True True True

The poly A tail is added to the RNA transcript in the lumen of the rough endoplasmic reticulum to protect and stabilize the transcript

Occasionally a double stranded DNA molecule contains a uracil base U What is a likely source of the base methylation of a thymine a none cleaved primer base Deamination of a cytosine residue an rUTP is incopoorated during DNA replication

A eukaryotic mutation upstream of a particular gene has been identified that changes the sequence of the TATA box to GATA How would you predict that this mutation would affect the transcription of this gene Transcription factors would bind in the middle of the gene sequence and transcribe the gene from that point Transcription factors would bind to the start point in the promoter region Transcription factor binding would be reduced or eliminated and transcription of the gene would decrease dramatically Transcription would proceed normally

Which of the following processes only occurs in eukaryotic gene expression RNA polymerase binds to the promoter A poly A tail is added to the 3 end of an mRNA and a cap is added to the 5 end Transcription can begin as soon as translation has assembled the first few amino acids in the polypeptide mRNA tRNA and rRNA are transcribed