1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For this activity we will use a 5 base

Question

1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For this activity we will use a 5 base pair primer Using this primer 5 GATAC 3 Show where the primer binds to your template DNA below Indicate the primer by using bold text Then act as the polymerase and fill in the rest of the new strand of DNA DNA polymerase can only add to the 3 M end of the new DNA strand New DNA strand Template DNA 3 3 TAGCTATGCGGACCTCATGCATTAGAGTA G 5 5

Kunduz · Accepted Answer

Click to see the answer