Question:
1. Transcribe and translate the DNA given below. Given below
Last updated: 7/7/2022
![1. Transcribe and translate the DNA given below. Given below](https://media.kunduz.com/media/sug-question/raw/84368790-1657231104.5686781.jpeg?h=512)
1. Transcribe and translate the DNA given below. Given below is the coding strand. 5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 3 2. Given below is the anticodon in a tRNA. What amino acid does this tRNA code for? (1) 5' CAU 3' 3. In a cell a certain a specific gene needs to transcribed. The cell activates this gene by acetylating histone. How is this helpful in activating the gene?