Question:
A third ssDNA same amount and same buffer is added in a new
Last updated: 4/28/2023

A third ssDNA same amount and same buffer is added in a new tube with the same 5000 nucleotide long single stranded DNA You repeat the same experiment and noticed that the forming of dsDNA starts immediately as soon as the cooling phase begins Curve 3 in the graph below dsDNA 100 Curve 3 Time Curve 1 Curve 2 Third ssDNA sequence TACGTACGTACGCGTACGTACGTA 2 Explain why this is happening with this last oligonucleotide but not with the first two