Question:
Below is a sequence of DNA on the CSF1PO locus.
Last updated: 7/26/2022

Below is a sequence of DNA on the CSF1PO locus. CCTATCATGTAGTCAGGTACTGGACGGGTATGGTATGGTATGGTATGGTATGGTATGGTATGGTATAATCCGAGATGGA A) What is the STR region in the above DNA sequence? B) How many repeats does it have?