Question:
Below is a sequence of DNA on the CSF1PO locus.
Last updated: 7/26/2022
![Below is a sequence of DNA on the CSF1PO locus.](https://media.kunduz.com/media/sug-question/raw/51574784-1658837167.9120386.jpeg?h=512)
Below is a sequence of DNA on the CSF1PO locus. CCTATCATGTAGTCAGGTACTGGACGGGTATGGTATGGTATGGTATGGTATGGTATGGTATGGTATAATCCGAGATGGA A) What is the STR region in the above DNA sequence? B) How many repeats does it have?