Question:
millan Learning Translate the mRNA starting at the first 5
Last updated: 4/1/2023
![millan Learning Translate the mRNA starting at the first 5](https://media.kunduz.com/media/sug-question-candidate/20230401013154837033-3736870.jpg?h=512)
millan Learning Translate the mRNA starting at the first 5 nucleotide assuming that translation occurs in an E coli cell 5 AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA 3 Enter the sequence using the one letter amino acid codes amino acid sequence If all tRNAs make maximum use of wobble rules but do not contain inosine how many distinct tRNAs are required to translat this RNA required number of distinct tRNAS