Question:

Mutation questions Transcribe then translate this normal

Last updated: 11/6/2023

Mutation questions Transcribe then translate this normal sequence of DNA all questions below will refer to this sequence 5 GGTATGGCCGCACAATAGTTGC 3 3 CCATACCGGCGTGTTATCAACG 5 I 18 19 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCAUAAUAGUUGC 3 Translate this sequence