Question:
Predict the amino acid sequences of peptides formed by
Last updated: 3/28/2023

Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence assuming that the reading frame begins with the first three bases in each sequence Construct the peptides using the one letter codes of the ammino acids O Macmillan GGUCAGUCGCUCCUGAUU UUGGAUGCGCCAUAAUUUGCU