Question:

PROBLEM V The following strand is on the template strand of

Last updated: 2/17/2023

PROBLEM V The following strand is on the template strand of

PROBLEM V The following strand is on the template strand of a hypothetical gene TCGCTGCATGGCTTCAGCCTCGTATCATTACCGACATATGTC 1 How many possible open reading frames can you see on the coding strand of this gene 2 Find the protein product of the first open reading frame of the coding strand Hint the reading frame produces a longer polypeptide rg Arg