RNA 1 List the 3 stages of Transcription 3pts The 3 stages
Last updated: 12/7/2023
![RNA 1 List the 3 stages of Transcription 3pts The 3 stages](https://media.kunduz.com/media/sug-question-candidate/20231207193730738898-4555708.jpg?h=512)
RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3