Anatomy and Physiology Questions

Consider the following DNA molecule Assume this is the DNA sequence of an entire chromosomes After replication what will be the sequence of its sister chromatid Explain the reasoning for your answer 4 marks 5 ATATGTACGGTCTTATTTACCCATACCTATT 3 5 3 TATCATGCCAGAATAAATGGGTATGGATAA

Column I 1 hepatitis 2 cirrhosis 3 cholelithiasis 4 colonic polyposis 5 jaundice 6 inflammatory bowel disease 7 diverticulosis 8 irritable bowel syndrome 9 hepatocellular carcinoma 10 gastroesophageal reflux disease Column II Column II A Yellow orange coloration of the skin and other tissues B Abnormal condition of small pouches or sacs in the wall of the intestine C Ulcerative colitis and Crohn disease D Inflammation of the liver E Abnormal condition of gallstones F Chronic disease of the liver with degeneration of liver cells G Small growths protrude from the mucous membrane lining the intestine H Contents of the stomach flow backwards into the esophagus I Signs and symptoms of GI distress but no lesions found in the GI tract J Primary cancer of the liver

Column I 1 gastr o 2 col o 3 proct o 4 cholecyst o 5 pharyng o 6 or o 7 hepat o 8 duoden o 9 ile o 10 pancreat o 1 hepatomegaly 2 cholecystectomy 3 proctoscopy 4 ileostomy 5 stomatitis 6 gastrojejunostomy 7 pancreatitis 8 duodenal with its meaning in Column 9 esophageal 10 gastralgia Column II Match the term in Column I with its meaning in Column Column I Column II A Mouth B Endocrine and exocrine gland near the stomach C Third part of the small intestine D Stomach E Liver F First part of the small intestine G Large intestine H Anus and rectum I Gallbladder J Throat 229 A Pertaining to the tube leading from the throat to the stomach B Pain of the stomach C Enlargement of the liver D Inflammation of the mouth E Pertaining to the first part of the small intestine F Removal of the gallbladder G Visual examination of the anus and rectum H New opening of the third part of the small intestine to the outside of the body I New opening between the stomach and second part of the small intestine J Inflammation of a gland adjacent to the stomach

1 cardioversion 2 thrombolytic therapy 3 heart transplantation 4 endarterectomy 5 CABG 6 PCI 7 cardiac catheter ablation A Surgery to detour around blockages in coronary arteries B Drugs such as tPA dissolve clots that may cause a heart attack C Balloon tipped catheter with stent opens coronary arteries D Flexible tube is threaded into the heart abnormal tissue is destroyed E Brief discharges of electricity stop a cardiac arrhythmia F Removal of innermost lining of an artery to eliminate fatty deposits G Donor heart is transferred to a recipient

Column I 1 hypertension 2 atherosclerosis 3 angina 4 shock 5 myocardial infarction 6 arrhythmia 7 congestive heart failure 8 aneurysm 1 lipid tests 2 MUGA scan 3 lipoprotein tests 4 Holter monitoring 5 angiography 5 cardiac enzyme test electrocardiography echocardiography estamibi scan H Hardening of arteries with cholesterol like plaque E Match the test or procedure in Column I with its description in Column II Column I Column II oppler ultrasound Column II A Abnormal heartbeat B Local widening of an artery C Heart attack D Chest pain E High blood pressure F Inability of the heart to pump its required amount of blood G Group of signs and symptoms pale skin weak rapid pulse and shallow respirations A Sound waves produce images of the heart B X ray images of blood vessels after contrast is injected into the bloodstream C Measurement of HDL and LDL in blood D Recording electricity through the heart E Measurement of substances in the blood that indicate a heart attack F Sound waves measure blood flow in vessels G Abnormal heart rhythms are detected with a compact ECG over a 24 hour period H Radioactive test to detect blood perfusion in heart muscle I Measurement of triglyceride and cholesterol levels in the blood J Radioactive

Column I 1 phleb o 2 arteriol o 3 angi o 4 venul o 5 arteri o 6 coron o Column I 1 intravenous 2 arteriosclerosis 3 phlebotomy 4 cardiomyopathy 5 angioplasty 6 arteriolitis 7 venulitis 8 aortic stenosis C Match the medical term in Column I with its meaning in Column II Column II 9 pericardium Column H 10 coronary A Artery B Vessel C Heart D Vein E Small artery F Small vein A Inflammation of small veins B Narrowing of the largest artery C Disease of heart muscle D Pertaining to within a vein E Inflammation of small arteries F Hardening of arteries G Incision of a vein H Surgical repair of blood vessels I Pertaining to the heart J Membrane surrounding the heart

descriptions You can tell me what should I look up for each description One description Step outward with your toes while keeping your feet shoulder width apart To push your chest out gently converge your shoulder blades Two description It specifically targets our thighs hamstrings quadriceps and glutes Third description For pushups nothing is utilized here The body s own weight serves as

Art labeling Activity Structure of a Lymph Node Close up View of Cortex Germinal center Subscapular space Dividing B cell Dendritic cells Capsule Capillary Nuclei of B cells Outer cortex Re

Tandem mass spectrometry generated 5 different sizes of fragments that still carry the N terminal tag Fragment 1 579 8 D Frament 2 448 5 D Frament 3 347 4 D Frament 4 218 3 D Frament 5 71 1 D Based on the information provided above determine the sequence of the original oligopeptide and draw its structure What is the

Why do tobacco control proponents seek bans on tobacco advertising and other promotional techniques Select one O a It may entice children to try tobacco O b It contributes to the maintenance of adult smoking O c Both of the above O d None of the above

Direct advertising pathways include all of the following EXCEPT Select one O a Create a political constituency for tobacco O b Reducing smokers readiness to quit Oc Enticing children to experiment with and initiate smoking Od Increasing smokers daily consumption by serving as cues to smoke

One of the most compelling reasons to ban tobacco advertising and promotions is the widespread belief that Select one O a These marketing techniques seduce young people into lives of nicotine addiction O b It influences adult thoughts on cigarette choice O c It does not explain children s preference to smoke heavily advertised brands of cigarettes Od These marketing techniques reduce the likelihood of nicotine addiction

The differences between advertising and counter advertising pathways as related to tobacco are that Select one O a Counter advertising are ways that promote smoking cessation O b Counter advertising are ways that discourage smoking cessation Oc Advertising are ways that promote smoking cessation Od All of the above

In 1967 the FTC recommended a substantially strengthened label that should include what Select one O a An age limit for smoking O b A bigger bolder print O c A dosage requirement Od The mention of diseases that smoking can cause

One of the first formal tobacco control policies was the requirement that cigarette packs Select one Oa Be sealed O b List all ingredients contained in the tobacco O c Bear a warning label O d Remove the caution listing

Publication of the Surgeon General s reports initially resulted in Select one O a No change in tobacco consumption O b An increase in tobacco consumption O c No report on tobacco consumption O d A decrease in tobacco consumption

Students of tobacco and health consider publication of the landmark Surgeon General s report of 1964 as Select one O a The beginning of the national antismoking campaign O b The exception to the rule for support of smokers O c The report that addressed the hazards of smokeless tobacco Od The mark of the billion dollar cigarette sales initiative

What two factors combine to account for the enormity of the disease burden of smoking Select one O a Prevalence of behavior and lethality of the chemicals in cigarettes Ob Access and money Oc Preexisting conditions and money Od Preexisting conditions and new keses

Human organs and biological functions that are impacted by smoking include Select one O a Risk of impotence in males O b Prolonged post surgical healing time O c Eyesight O d All of the above

Select one O a Lung cancer would impact only males Lung cancer would affect the respiratory system O b O C Lung cancer was curable O d Lung cancer would continue to be a rare medical condition

The World Health Organization projects that by 2030 the toll of smoking will claim Select one O a 100 lives annually O b 100 million lives annually O c 1 million lives annually O d 10 million lives annually

The CDC estimates that smoking caused an annual economic toll of from 1995 to 1999 in the U S Select one O a 15 million O b 1 trillion O c 1 million O d 157 billion

Lung cancer Select one Oa Was a very rare phenomenon in the early 1900 O b Grew at an astonishing rate to become the leading cause of death among both men and women O c Was found to be the cause of death for 125 000 individuals between 1995 and 1999 Od Is true for all of the above

For life long smokers and former smokers Select one O a An oxygen tank will become a necessary part of everyday life for them O b Smoking affects a remarkably high percentage of human organs and biological function O c The risk of impotence may occur in men Od A and B O e B and C

The most important tobacco produced disease cause of death is Select one O a Lung cancer O b Cardiovascular diseases O c Respiratory diseases O d None of the above

stion 5 nly two parts a summary and a The best and most effective delivery method is speaking

statements are words that bridge previous parts of your presentation to the next part provide the airflow needed to make our vocal folds vibrate

Historically smoking diffused into widespread use decades before science had explicated its Select one O a Proper use O b Recommended daily allowance O c Dangers O d Usefulness

Your speech summary will consist of an extremely brief review of your stion 2 Occasions for speaking may come from a job interview or questioning from an investigator or journalis

Unlike most other legal consumer products ingested into the body cigarettes and other tobacco products Select one O a are under the same strict regulations as alcohol O b are subject to strict product regulation Oc are legal for minors and adults O d are subject to virtually no product regulation

Global transport of organisms by humans provides novel resources to wild species which often respond maladaptively Native herbivorous insects have been killed feeding on toxic exotic plants which acted as ecological traps 4 We document a novel eco evolutionary trap stemming from the opposite effect that is high fitness on an exotic resource despite lack of adaptation to it Plantago lanceolata was introduced to western North America by cattle ranching Feeding on this exotic plant released a large isolated population of the native butterfly Euphydryas editha from a longstanding trade off between maternal fecundity and offspring mortality Because of this release and despite a reduced insect developmental rate when feeding on this exotic Plantago immediately supported higher larval survival than did the insects traditional host Collinsia parviflora Previous work from the 1980s documented an evolving preference for Plantago by ovipositing adults We predicted that if this trend continued the insects could endanger themselves because the availability of Plantago to butterflies is controlled by humans who change land management practices faster than butterflies evolve Here we report the fulfilment of this prediction The butterflies abandoned Collinsia and evolved total dependence on Plantago The trap was set In 2005 humans withdrew their cattle springing the trap Grasses grew around the Plantago cooling the thermophilic insects which then went extinct This local extinction could have been prevented if the population had retained partial use of Collinsia which occupied drier microhabitats unaffected by cattle removal The flush of grasses abated quickly rendering the meadow once again suitable for Euphydryas feeding on either host but no butterflies were observed from 2008 to 2012 In 2013 2014 the site was naturally recolonized by Euphydryas feeding exclusively on Collinsia returning the system to its starting point and setting the stage for a repeat of the anthropogenic evolutionary cycle In his 1999 address to the Ecological Society of America Gary Polis described Homo sapiens as a ubiquitous keystone pest and so we have proven to be Although adaptation to human activities enables some wild species to coexist with us many fail to adapt to human land man agement and suffer in consequence An example of this is the setting by humans of ecological traps9 10 which are defined as follows in an environment altered suddenly by human activities an organism makes maladaptive habitat choices based on formerly reliable environmental cues despite availability of higher quality habitat 0 Most ecological traps result from preference by wild organisms for novel resources that are unsuitable or toxic Australian monitor lizards suffered population crashes after feeding on toxic exotic cane toads Bees have maladaptively preferred crops grown from seed treated with neonicotinoid insecticides 2 2 Several examples have involved insect her bivores feeding on exotic host plants that reduced insect fitness 4 but

Read this article and take insights from Week 3 class on why social media engagement is important for any business and share your thoughts on why is it important in less than 450 words

Which of the following is the most accurate definition of a system a It is a group of parts that are connected to each other in an additive fashion like A B C Ob It is a group of interdependent parts that together contribute to unified whole or purpose O c It is a group of elements that happen to occupy a similar space and that mimic each other s roles d It is a group of elements that are hierarchically nested with parts at the top dominating functioning

Read through the Sustainable Development Goals as described on the Agenda2030 website Describe if you can any assurances contained therein with regard to human rights and individual freedom Do you ge the impression that these goals are truly quantifiable Do you agree with Amartya Sen that democracy and human rights are key for sustainable development

Based on the quotations provided in the discussion above do you think that Orwell s essay What Is Science might still describe a valid perspective on science and its institutions Bear in mind that this essay was written in 1945 only a couple of months after the atomic bombings of Japan and after the US and USSR had both recruited German weapons scientists with the Nazi defeat

Template for Cell Tissue Drawings A P 1 Number of Drawing Cell Tissue Name melafhose Magnification 600 X Number of Drawing Cell Tissue Name Anaphase Magnification 600

III Define It Part 2 DIRECTIONS Based on what you have learned in this chapter define each of the following in your own words and create a sentence using the word 1 luminous 2 luminary 3 illuminate 4 lucid 5 elucidate hinate 7 pho lucid 6 photon an engery elucidate photon photosynthesis

composed of cell in a fluid matrix supports and protects insulates against heat loss reserve fuel source supports and protects stores calcium provides tensile strength with the ability to absorb compressive shock forms tendons and ligaments

stratified squamous epithelium cardiac muscle simple cuboidal epithellum skeletal muscle simple squamous epithelium 21 2 PRES PAR Spor

Which of the following statements is true O Loose connective tissue includes cartilage O Dense connective fissue is dominated by collagen fibers Closely packed bundles of collagen fibers are characteristic of loose connective te O Denise irregular connective lissue has a high proportion of elastic fibers

Ford to develop an advertising plan that will assist in the clarification of the organization s objectives and the strategy by which it will meet those objectives Please answer the following question in 10 sentences or less What is the importance of Ford having an advertising and IBP plan and what are the key sections in an ad plan

Vanilla Chocolate Figure 2 6 A Three Tiered Cake as an Example of Contour Lines The graphic to the left is a cross section seen from the side and the graphic on the right is a bird s eye view from above 26 7 Refer to Figure 2 6 26 Figure by Jeremy Patrich is licensed under CC BY NC SA 4 0 34 Lab 2 Map Interpretation a Observing the cake what do you notice about each of the three layers Do they cross or mix or are they parallel to one another Is the cake symmetrical or is it asymmetrical b Assume that each layer of cake has a height of 6 six inches and that the bottom of the cake is at 0 zero inches i Label each line shown on the right side of Figure 2 6 with its height What is the total relief of the cake Hint how tall is the cake ii c Now imagine that this cake was a hill Which side of the hill has a steeper gradient How do you know Hint observe the contour lines or the perimeter of the circles Topographic maps show lines for selected elevations otherwise the map would be too confusing to read The elevation difference between contour lines is called the contour interval If a topographic map has a 10 foot contour interval that means that each line represents a 10 foot elevation difference between them Whether the contour interval is a 5 foot 10 foot or 100 foot interval depends on the local topography

Pectoral lymph node Parasternal lymph node Axillary lymph nodes Central lymph node Pectoralis major muscle Subclavian lymph node Mammary gland Subscapular lymph node Axillary vein 72

All adjective suffixes mean pertaining to A True B False Question 5 1 Point A combining form is usually created by adding a o after a root

Identify the highlighted vessel P Pearson

Identify the highlighted vessel Renal artery From LT VA16 Life size Muscle Torso 27 part 30 Scientific

S 3 The chronic tests may last over one or more generations Duration of chronic tests involving longer life span test organisms takes significant proportion of their life including gestational period of females and spermatogenesis of male test organisms Generally chronic and sublethal toxicity tests last for a significant portion of an organism s life expectancy Reproductive tests often examine the reproductive capabilities of an organism By their nature these tests must include 1 the gestational period for females and 2 a significant portion of the time for spermatogenesis for males Growth assays may include an accounting of biomass produced by protists and algae or the development of newly hatched chicks Sublethal endpoints including reproductive immune endocrine and developmental dysfunction are generally associated with chronic toxicity Nevertheless chronic exposure also can result in direct mortality not observed during acute exposure For example chronic exposure of highly lipophilic substances can result in the ultimate bioaccumulation of the chemical to concentrations that are lethal to the organisms In principle ecotoxicity tests can be carried out at any level in the biological hierarchy of systems ranging from molecules to ecosystems The methods range from single species studies through multispecies studies to tests which attempt to measure and determine the effect of chemicals in the field in natural ecosystems Single species toxicity tests apply one single species for testing the effect of chemicals These species are well known organisms deriving from controlled cultures Single species are used in most of the laboratory bioassays and toxicological tests Multispecies toxicity tests as their name implies involve the inclusion of two or more organisms and are usually designed so that the organisms interact The effects of a toxicant upon various aspects of population dynamics are a goal of these tests In the field of microbiology the competition test of two bacterial species uses the competing bacterial strains grown together in the test medium A special relation is tested in the prey predator tests Food chain effects can be tested using the members of the food chain

Read the following information about income in the United States and answer the question below In 1939 the median income of African Americans was 41 percent of the median white income In 1950 the median income of African Americans had risen to 60 percent of the median income of whites Which reason best explains this shift in income A passage of civil rights laws B integration of armed forces C incentives for small businesses D employment in defense industries

Source Public Domain Library of Congress Which phrase describes the goal of this invasion A to eliminate German resistance on the Italian Peninsula B to counter the German offensive at the Battle of the Bulge C to launch a massive attack against the Germans in North Africa D to open a western front to force the German army back to Berlin

Use the Image to answer the question Cu nto cuesta una hamburguesa APERITIVOS Ensalada Papas Fritas Sopa PLATOS Hamburguesa Pizza Tacos POSTRES Helado Pastel BEBIDAS Refresco Limonada O Cuesta veinticinco d lares O Cuesta doce d lares O Cuesta diez d lares 6 6 7 25 18 20 10 12 8 10 Restaurante El Profe 123 Calle Donde Seal 10AM a 8PM La V