Anatomy and Physiology Questions

Match the following stages of the sleep cycle to their respective features 50 Delta Most variable EEG Spindles K Complexes Entirely Theta 50 Delta Alpha or Beta Choose Stage 2 Awake REM Stage 1 Stage 3 Stage 4 Choose Choose Choose

Again for each of the following indicate whether it is most likely to be associated with Wernicke s Broca s or Conduction Aphasia Also called Receptive Aphasia Unable to comprehend a command such as Go to the red door Unable to comprehend the difference between Put red on green and Put green on red Damage to the Planum Temporale Deficits in Sign Language Choose Broca s Wernicke s Conduction Choose Choose Choosel

Indicate whether each of the following does or does not tend to occur in REM sleep Atonia K Complex PGO Wave GABA at its highest level Rebound after deprivation ACh activity in the cortex Longest wavelength EEGS Dreaming Choose Does not Does Chat Choose Choose Choose Choose Choose Choose

Again select the Hormone on the right that is most associated with the function on the left Stimulates sperm production Is released at time of orgasm regardless of gender Is generally required for sexual arousal in men Released by Hypothalamus to trigger adolescent development across genders Produces Refractory Period in male sexual response Initiates escalation of sexual arousal via contact with Anterior Pituitary Choose GnRH Testosterone Oxytocin Prolactin Choose Choose Choose Choose

Indicate if the following is TRUE or FALSE of the Gambling Task a Subjects with prefrontal lesions develop anticipatory anxiety b Subjects with amygdala lesions show no reaction to penalties c Subjects with intact prefrontal but damaged amygdala still learn to avoid worst cards Select

Indicate which emotional brain area is most likely to be critically involved in the following Damage leads to inability to recognize emotional expression esp re approachability Damage leads to inability to spontaneously smile Is the source of the innate Startle Reflex Is involved in Emotional Facial Paresis Choose Main site seriously damaged in Phineas Gage Choose Plays a major role in conditioned fears that enhance the Startle Reflex Orbito frontal Cortex Anterior Insula Amygdala Choose Choose Choose

Match the following arousal systems to their respective features Net that rus up through brainstem Typically brief activation Arouses or inhibits cortex For vigalence surprise Alerts memory Releases ACh Glutamate including to Thalamus Choose Basal Forebrain Reticular Formation Locus Coeruleus Choose Choose Choose

Select the Hormone on the right that is most associated with the function on the left Stimulates milk production in women Released by Pituitary in response to Gonadotrophin Releasing Hormone One function is regulating the menstrual cycle Is an androgen produced by the adrenal glands High levels may be linked to aggression Produces secondary hair growth in women Choose Prolactin Androstenedione Testosterone FSH LH Choose Choose Choose Choose

Again indicate for each of the following whether the newborn s anatomy will be likely to appear primarily Female or Male The fetus developed a very large Sexually Dimorphic Nucleus The fetus was Androgen Insensitive The fetus had a normal Y chromosome The fetus was XO Turner s syndrome Choose Female Male Chorus Choose Choose

Indicate for each of the following whether the newborn s anatomy will be likely to appear primarily Female or Male The fetus has a TDF deficit The fetus developed a normal Wolffian system As a teen the person s secondary hair growth is mainly a result of gonad rather than adrenal activity The fetus had two normal X chromosomes The fetus produced Anti Mullerian Hormone Choose Male Female Choose Choose Choose Choose

63 Edema is characteristic in O a marasmus O b kwashiorkor

60 What would not be allowed to a low sodium diet O a beef loin O b fish Oc pork lain O d turkey roll

75 What is equal to 2 medium meat fat meat exchanges a 2oz cheese O b 4oz tofu O c 2oz boneless pork chops O d 2 Tbsp peanut butter

70 A woman is edematous because of O a extracellular depletion O b interstitial retention O c interstitial depletion O d extracellular retention

8 Urea excretion is related to a protein intake muscle mass O b protein intake adipose reserves Oc protein intake calcium intake O d muscle mass protein intake while creatinine excretion is related to

86 What is the limiting amino acid in vegetable sources other than legumes O a lysine O b isoleucine O c methionine O d tyrosine

67 An elderly man has constipation and high cholesterol What would you tell him to eat daily O a bran cereal and milk O b dried beans Oc green beans Od whole wheat bread

58 Which foods eaten daily would be the best to help lower cholesterol O a 1 2c dried beans for soluble fiber O b 1 slice whole wheat bread

20 Absorption of cholesterol increases when dietary fat is also present in the intestine O a True Ob Falte

34 Net protein utilization measures how O a Adequately the protein in a food is digested O b Easily nitrogen is converted to glucose O c O d Much dietary protein the body retains and uses Well the body recycles amino acids

24 The condensation of alcohol and fatty acids make a ester called a triglyceride O a True O b False

80 IDDM patient has a high occurrence of insulin reactions at night The bedtime snack should be O a crackers 1 slice cheese O b bagel with cream cheese Oc crackers 1 2c orange juice

71 Which of the classified as a conditionally amino acid O a Phenylalanine O b Lysine O c Arginine O d Serine

12 Fats are generally cleared from the bloodstream O a 30 minutes O b 10 hours Oc 2 hours O d 4 hours after a meal

O a The ability of sorbitol to sweeten is equal to that of sucrose O b gram for gram they are equal in kcal sorbitol has 0 kcalories per gram Oc

85 Why does fat contain more calories than carbohydrates and protein O a more oxygen C less H O b more O H less C Oc more C H less oxygen

84 What would you recommend to low income groups as a cheap source of protein O a legumes O b cheese OC fish O d poultry

7 A frozen dinner has 36 grams CHO 17 grams protein 15 grams fat What are the exchanges in this meal O a 21 2 bread 2 meat 1 fruit 2 fat O b 3 starch 3 meat 1 fruit Oc 2 starch skim milk 2 fat 1 meat

te goals for the NIDD pt O a rapid wt loss Afasting blood glucose f need for OHA oral hypoglycemia agents moderate wt loss Bfasting blood glucose fneed for OHA rapid wt loss Cfasting blood glucose u need for OHA O b Oc

79 If a person has uncontrolled diabetes ketosis what is a potential result O a decreased HgBA1C O b sodium potassium depletion O c protein synthesis O d high cholesterol

65 Who is more at risk for kwashiorkor O a renal patient on supplements O b surgery patient on D5W for two weeks O c cancer patient with anorexia O d 15 year old anorexic girl taking chemotherapy

33 A high quality protein does all of the following except O a Is easy to digest O b Supply all the essential amino acids in amounts needed by the body O c Regulate blood sugar levels O d Provide enough amino acids to supply nitrogen for nonessential amino acid synthesis

39 In maintaining proper acid base balance proteins act as O a Antibodies O b Enzymes Oc Hormones Od Buffers

72 Blood sugar which you should be most concerned about O a 80 yo man with fractures BG 190 200 Ob younger woman with arthritis BG 130 140 Oc 12 yo boy with broken leg BG 190 200 Od older woman with arthritis BG 130 140

81 As a nurse you have a newly diagnosed patient with the following labs I cholesterol 307 II HDL Chol 45 III glucose 250 IV triglycerides 450 Which do you addresses first Ob N OCM Od B

Cytokinesis is a process during which a belt of proteins pinches a n into the cell splitting it in to two cells A split equator C cleavage cravasse B cleavage furrow D equatorial slice

Step 4 Write a paragraph which explains the position of a senator

Sexual selection is the development of a selection pressures on traits related to reproduction b natural selection processes that occur via reproduction c traits related to secondary sexual characteristics d traits that help an individual compete for mates

Step 5 Write a summary of the accomplishments of a Previous Senator

22 Critics of the 2017 study claim that the data do not accurately reflect the incidence of CTE in the wider population of football players because the data set is inherently biased Considering the information about the brains used for this study what do you think Justify your answer

Prevalence of STIS Answer the following questions about the prevalence of STIs by giving your best guess as to the ate of each You will have a chance to compare your stimations with available data rom the CDC About 1 In people aged 14 49 In the U S has HSV type 2 genital herpes What percentage of people with genital herpes don t know they are infected Enter a percentage number from 0 to 100 Human Papillomavirus HPV is a group of viruses that are different from the types of viruses that cause herpes and HIV HPV can cause warts and health problems including

Which of the following will reduce one s chances of contracting an STI Multiple Choice communicating with one s partner about STIs before sex taking an oral contraceptive wearing two condoms Instead of one brushing one s teeth after oral sex

Multiple Choice O O an expectation that one will fall in love and live happily ever after an erroneous belief that one has acquired an STI following a risky sexual encount a bellef in a certain personal uniqueness or Invulnerability a belief in a divine Intervention that will cure STIs and other diseases

Although Thomas s partner demands that he wear a condom when they have sex he thinks it is a ridiculous expectation He knows that he and his partner are fine and insists nothing bad will happen to them Which concept best describes Thomas s thinking Multiple Choice O cognitive distortion personal fable O probabilistic estimation

ion Practice Complete the lines below by determining the mRNA transcript and amino acid sequence Compare the mutant DNA strands to the wild type strand Circle the mutation in the mutant DNA strands and describe the type of mutation frameshift in point missense point silent or point nonsense Not all of these will be frameshift deletion this assignment Wild type DNA template mRNA transcript sequence Amino acid sequence 3 TACGCGTGCACGATGCAGTAGTACATC5 Mutation 1 DNA template 3 TACGCGTGCACGATCCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence Type of mutation Mutation 2 DNA template 3 TA CGCGTGCTCGATGCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence Type of mutation Mutation 3 DNA template 3 TA CGCGCTGCACGATGCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence ype of mutation Mutation 4 DNA template 3 TACGCGTGCACGATGCAGTAATACATC5 RNA transcript sequence

What is a primary difference between descriptive statistics and inferential statistics a Inferential statistics allow us to discuss causal relationships about the population b Descriptive statistics do not allow us to evaluate a normal distribution of scores in the population c Descriptive statistics allow us to examine patterns of behaviors in large groups of people d Inferential statistics do not allow us to reject the null hypothesis

stion will save this respo ty as systematic obse

to another question will difference between a th ory is a statement a hy

ing an experimenta ent variable nt variable ing variable ariable

Mastering Assignments Pre Lab Quiz 6 Nervous Tissue and the Human Brain Item 15 Amygdala Caudate nucleus Pons Hippocampus Lateral ventricles 1