Introduction to Physiology Questions and Answers
![83 Which of the following strucutres indicated on the schematic drawing forms glycocalix 2 84 Which of the following types of connective tissue is presented on the histologic slide below A dense regular B reticular D adipose areolar low which labe](https://media.kunduz.com/media/sug-question-candidate/20230205120151623317-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology83 Which of the following strucutres indicated on the schematic drawing forms glycocalix 2 84 Which of the following types of connective tissue is presented on the histologic slide below A dense regular B reticular D adipose areolar low which labe
![97 Which of the following organs are lined by 98 The structu the epithelial tissue presented on the histologic histologic slide below is slide below A stomach B trachea bladder oesophagus 99 Which of the following tissues is presented on the histologic slide below A Simple squamous B Simple cuboidal Simple columnar D Pseudostratified sta A Mitochondria B Neurofilaments Nissle bodies D Golgi complex 100 Which of the following structures ar shown on the histologic slide below A intersticial lamellae Haversion system C outer generalized lamellae D inner generalized lamellae](https://media.kunduz.com/media/sug-question-candidate/20230205120414185821-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology97 Which of the following organs are lined by 98 The structu the epithelial tissue presented on the histologic histologic slide below is slide below A stomach B trachea bladder oesophagus 99 Which of the following tissues is presented on the histologic slide below A Simple squamous B Simple cuboidal Simple columnar D Pseudostratified sta A Mitochondria B Neurofilaments Nissle bodies D Golgi complex 100 Which of the following structures ar shown on the histologic slide below A intersticial lamellae Haversion system C outer generalized lamellae D inner generalized lamellae
![D Repair of cell membrane damage 7 Which of the following structure function pairs is correct A Microtubule low resistence pathway between adjacent cells B Ribosome location of steroid synthesis C Inner mitochondrial membrane site of electron transport system D Golgi apparatus mitochondrial formation D Which of the following is not true of the lasma membrane A contains receptors for communication B forms intercellular connections C is a rigid sheet of molecules with little flexibility D regulates material movement into and out of the cell D lysosomes 8 Which of the following events occurs during telophase of mitosis A Chromatids separate R Chromosomes coil Nuclear envelope disappears Chromosomes uncoil OR A 10 Which of the following structure function pairs is correct A SER ribosome formation B Golgi apparatus protein synthesis C Microtubule electron transport system D lysosomes intracellular digestion](https://media.kunduz.com/media/sug-question-candidate/20230205114212169356-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyD Repair of cell membrane damage 7 Which of the following structure function pairs is correct A Microtubule low resistence pathway between adjacent cells B Ribosome location of steroid synthesis C Inner mitochondrial membrane site of electron transport system D Golgi apparatus mitochondrial formation D Which of the following is not true of the lasma membrane A contains receptors for communication B forms intercellular connections C is a rigid sheet of molecules with little flexibility D regulates material movement into and out of the cell D lysosomes 8 Which of the following events occurs during telophase of mitosis A Chromatids separate R Chromosomes coil Nuclear envelope disappears Chromosomes uncoil OR A 10 Which of the following structure function pairs is correct A SER ribosome formation B Golgi apparatus protein synthesis C Microtubule electron transport system D lysosomes intracellular digestion
![13 Oxytocin is hormone of A Adenohypophysis B Adrenal cortex Neurohypophysis D Thyroid gland 5 choose one correct answer thyroid gland A is composed of rounded epithelial structures called thyroid follicles B synthesizethyroxine tetra iodothyronine or T4 and tri iodothyronine T3 C a central lumen is filled with a gelatinous substance called colloid 9 all of them are correct 14 Steroid hormone secreting cells do not store their product in granules is description of A Adenohypophysis Adrenal cortex C Neurohypophysis D Parathyroid gland 16 Two types of cells presented in parathyroid glands are A chief cells and oxyphilic cells B Follicular and parafollicular cells C chromophils and chromophobes D basophils and acidophils](https://media.kunduz.com/media/sug-question-candidate/20230205115906960511-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology13 Oxytocin is hormone of A Adenohypophysis B Adrenal cortex Neurohypophysis D Thyroid gland 5 choose one correct answer thyroid gland A is composed of rounded epithelial structures called thyroid follicles B synthesizethyroxine tetra iodothyronine or T4 and tri iodothyronine T3 C a central lumen is filled with a gelatinous substance called colloid 9 all of them are correct 14 Steroid hormone secreting cells do not store their product in granules is description of A Adenohypophysis Adrenal cortex C Neurohypophysis D Parathyroid gland 16 Two types of cells presented in parathyroid glands are A chief cells and oxyphilic cells B Follicular and parafollicular cells C chromophils and chromophobes D basophils and acidophils
![5 Which of the following cells is presented on the electron micrograph bellow A Steroid secreting cell Cell involved in protein synthesis C Cell involved in transport of ions D Dividing cell 6 Which of the following proteins forms the structure presented on the electron micrograph below Myosin Tubulin C Actin D Kinesin](https://media.kunduz.com/media/sug-question-candidate/20230205114240610538-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology5 Which of the following cells is presented on the electron micrograph bellow A Steroid secreting cell Cell involved in protein synthesis C Cell involved in transport of ions D Dividing cell 6 Which of the following proteins forms the structure presented on the electron micrograph below Myosin Tubulin C Actin D Kinesin
![20 Which structure Actrite al body Jer hasis of the cli D](https://media.kunduz.com/media/sug-question-candidate/20230205114402461613-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology20 Which structure Actrite al body Jer hasis of the cli D
![11 All the following statements are true of Golgi apparatus except A It appears as a group of flat vesicles with peripheral dilations It is involved in the lysosome formation It is involved in the protein synthesis D it has two surfaces called entry face and exit face 12 All the following statements are true of smooth endoplazmic reticulum except A It is abundant in the steroid synthesizing cells B It is well developed in the protein synthesizing cells C Intercommunicates with the RER D Participates in the contaction processes of the muscle cells](https://media.kunduz.com/media/sug-question-candidate/20230205114226655256-4754400.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology11 All the following statements are true of Golgi apparatus except A It appears as a group of flat vesicles with peripheral dilations It is involved in the lysosome formation It is involved in the protein synthesis D it has two surfaces called entry face and exit face 12 All the following statements are true of smooth endoplazmic reticulum except A It is abundant in the steroid synthesizing cells B It is well developed in the protein synthesizing cells C Intercommunicates with the RER D Participates in the contaction processes of the muscle cells
![Question 49 Points 1 Choose the correct answer Tone refers to the writer s attitude toward the subject Creader boss](https://media.kunduz.com/media/sug-question-candidate/20230205074734385286-5336301.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyQuestion 49 Points 1 Choose the correct answer Tone refers to the writer s attitude toward the subject Creader boss
![GradeResus My Activities Websites that are not well known may have a great source of information librarian that can help you Chidden agenda database to help you find great information what you want to do a](https://media.kunduz.com/media/sug-question-candidate/20230205075142243659-5336301.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyGradeResus My Activities Websites that are not well known may have a great source of information librarian that can help you Chidden agenda database to help you find great information what you want to do a
![Question 38 Points 2 Choose the correct in text citation for the given quote according to the MLA formatting style A good novel tells us the truth about its hero but a bad novel tells us the truth about its author O Chesterton 11 O Chesterton 11 O Chesterton and 11 O Chesterton 11](https://media.kunduz.com/media/sug-question-candidate/20230205070212042982-5336301.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyQuestion 38 Points 2 Choose the correct in text citation for the given quote according to the MLA formatting style A good novel tells us the truth about its hero but a bad novel tells us the truth about its author O Chesterton 11 O Chesterton 11 O Chesterton and 11 O Chesterton 11
![Choose the correct answer The last sentence of the first paragraph of your exploratory essay should be a Othesis statement Ostatement of research hanging indent shocker](https://media.kunduz.com/media/sug-question-candidate/20230205051601886195-5336301.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyChoose the correct answer The last sentence of the first paragraph of your exploratory essay should be a Othesis statement Ostatement of research hanging indent shocker
![Choose all of the intermolecular forces present in a pure solution of the following molecule H H H C N H HHH ion dipole dipole induced dipole Odispersion forces VDW Ohydrogen bonding ion induced dipole dipole dipole](https://media.kunduz.com/media/sug-question-candidate/20230205045128367486-4759328.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyChoose all of the intermolecular forces present in a pure solution of the following molecule H H H C N H HHH ion dipole dipole induced dipole Odispersion forces VDW Ohydrogen bonding ion induced dipole dipole dipole
![Question 5 1 pts Of the following what factor will be the most influential when considering the hydrostatic pressure of fluid O the number of protein and or glucose molecules O the strength of the basement membrane](https://media.kunduz.com/media/sug-question-candidate/20230203200840227870-3830272.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyQuestion 5 1 pts Of the following what factor will be the most influential when considering the hydrostatic pressure of fluid O the number of protein and or glucose molecules O the strength of the basement membrane
![From the image above select all of the statements that are true Select all that apply B will contain intracellular fluid O C is called the interstitial space A will contain intracellular fluid O D is indicating fluid between cells fluid is able to move between all 3 spaces as needed the 3 spaces in the body that contain fluid are the intracellular interstitial and extracellular careful this may be](https://media.kunduz.com/media/sug-question-candidate/20230203200817424707-3830272.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyFrom the image above select all of the statements that are true Select all that apply B will contain intracellular fluid O C is called the interstitial space A will contain intracellular fluid O D is indicating fluid between cells fluid is able to move between all 3 spaces as needed the 3 spaces in the body that contain fluid are the intracellular interstitial and extracellular careful this may be
![Choose the answer that is NOT part of the lymph system Choose an incorrect answer regarding parts of the lymph system O pituitary O thymus O spleen O tonsils](https://media.kunduz.com/media/sug-question-candidate/20230203195734854195-3830272.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyChoose the answer that is NOT part of the lymph system Choose an incorrect answer regarding parts of the lymph system O pituitary O thymus O spleen O tonsils
![9 Federal and provincial taxes are calculated on an employee s a Salary b Allowances and benefits c Gross taxable income d Pensionable and insurable](https://media.kunduz.com/media/sug-question-candidate/20230203161803976958-4511073.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology9 Federal and provincial taxes are calculated on an employee s a Salary b Allowances and benefits c Gross taxable income d Pensionable and insurable
![Application When patients are dehydrated doctors administer IV fluids Explain why IV fluids cannot simply be pure water and why they would have to include some salt Remember that there is some salt inside each and every cell](https://media.kunduz.com/media/sug-question-candidate/20230203041825789009-3110841.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyApplication When patients are dehydrated doctors administer IV fluids Explain why IV fluids cannot simply be pure water and why they would have to include some salt Remember that there is some salt inside each and every cell
![Body compartments capillary wall cell membrane plasma ECF interstitial fluid intracelluar fluid ICF ECF extracellular fluid compartment fluid outside cells ICF intracellular fluid compartment fluid inside the cells Interstitial fluid fluid that surrounds the cell Plasma liquid component of blood The line between plasma and interstitial fluid is dotted the cells that line the capillaries are slightly leaky which means that ions can move freely between plasma and the interstitial fluid This results in solute concentration being identical in plasma and interstitial fluid 1 Based on the diagram above and the caption what are the two major compartments in which body Fluids can be found 2 The plasma component of the blood is in which of these compartments 3 In the human body solute concentration in the extracellular fluid influences cell volume How would high salt concentration in this compartment affect cell volume](https://media.kunduz.com/media/sug-question-candidate/20230203033017669171-3110841.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyBody compartments capillary wall cell membrane plasma ECF interstitial fluid intracelluar fluid ICF ECF extracellular fluid compartment fluid outside cells ICF intracellular fluid compartment fluid inside the cells Interstitial fluid fluid that surrounds the cell Plasma liquid component of blood The line between plasma and interstitial fluid is dotted the cells that line the capillaries are slightly leaky which means that ions can move freely between plasma and the interstitial fluid This results in solute concentration being identical in plasma and interstitial fluid 1 Based on the diagram above and the caption what are the two major compartments in which body Fluids can be found 2 The plasma component of the blood is in which of these compartments 3 In the human body solute concentration in the extracellular fluid influences cell volume How would high salt concentration in this compartment affect cell volume
![Remember cell walls are semi permeable which means they only allow certain substances to pass through freely For these questions it s not the solute that moves it s the water A way to quickly visually assess the direction of water movement Water follows salt if there s salt on both sides of the semipermeable membrane then water moves toward the side with more salt to balance out the concentration on both sides and make them equal 1 Define osmolarity You can use its mathematical definition or describe what it is in words Describe the net direction of fluid movement in each of the cases above into or out of the cell 1 Hypotonic solution 2 Isotonic solution 3 Hypertonic solution](https://media.kunduz.com/media/sug-question-candidate/20230203032939666768-3110841.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyRemember cell walls are semi permeable which means they only allow certain substances to pass through freely For these questions it s not the solute that moves it s the water A way to quickly visually assess the direction of water movement Water follows salt if there s salt on both sides of the semipermeable membrane then water moves toward the side with more salt to balance out the concentration on both sides and make them equal 1 Define osmolarity You can use its mathematical definition or describe what it is in words Describe the net direction of fluid movement in each of the cases above into or out of the cell 1 Hypotonic solution 2 Isotonic solution 3 Hypertonic solution
![For each of the following indicate whether other things being equal they will increase the likelihood of a post synaptic response or decrease the likelihood of a post synaptic response A chemical that interferes with reuptake of intact NT A chemical that slows the production of vesicles A shortage of recycler Glia in the synaptic cleft An increase in dendritic spines The failure of an Auto Receptor Inactive Kinesin molecules Choose Increase Decrease Choose Choose Choose Choose Choose](https://media.kunduz.com/media/sug-question-candidate/20230203003558174767-3636637.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyFor each of the following indicate whether other things being equal they will increase the likelihood of a post synaptic response or decrease the likelihood of a post synaptic response A chemical that interferes with reuptake of intact NT A chemical that slows the production of vesicles A shortage of recycler Glia in the synaptic cleft An increase in dendritic spines The failure of an Auto Receptor Inactive Kinesin molecules Choose Increase Decrease Choose Choose Choose Choose Choose
![A key is to a lock as a O neurotransmitter receptor is to a receptor neurotransmitter terminal button neurotransmitter neurotransmitter terminal button](https://media.kunduz.com/media/sug-question-candidate/20230202215318646768-5005644.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyA key is to a lock as a O neurotransmitter receptor is to a receptor neurotransmitter terminal button neurotransmitter neurotransmitter terminal button
![The primary reason why researchers calculate an inferential statistic on the data that they collect is because they want to prove beyond a doubt that their hypothesis is correct need to in order to get their research published in a professional journal want to determine the statistical significance of their results want to establish the reliability and validity of their methodology](https://media.kunduz.com/media/sug-question-candidate/20230202214657728445-5005644.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyThe primary reason why researchers calculate an inferential statistic on the data that they collect is because they want to prove beyond a doubt that their hypothesis is correct need to in order to get their research published in a professional journal want to determine the statistical significance of their results want to establish the reliability and validity of their methodology
![What according to Paine is the natural state of man in his essay Common Sense O All are born equal O All have inherent evil O Some are more equal than others Being dominant over others](https://media.kunduz.com/media/sug-question-candidate/20230202081440449107-5336301.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhat according to Paine is the natural state of man in his essay Common Sense O All are born equal O All have inherent evil O Some are more equal than others Being dominant over others
![Use the following research question to answer the corresponding questions below Does health coaching reduce feelings of burnout among remote working employees The population is The independent variable is The dependent variable is Choose feelings of burnout remote working employees remote work or no remote work health coaching received or not health coaches Choose](https://media.kunduz.com/media/sug-question-candidate/20230202021102793984-4170380.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyUse the following research question to answer the corresponding questions below Does health coaching reduce feelings of burnout among remote working employees The population is The independent variable is The dependent variable is Choose feelings of burnout remote working employees remote work or no remote work health coaching received or not health coaches Choose
![What is a cation O an atom that gains one or more electrons and acquires a net negative charg an atom that shares its valence electrons O a molecule that has both positive and negative charges an atom that loses one or more electrons and acquires a net positive charge](https://media.kunduz.com/media/sug-question-candidate/20230201022650995278-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhat is a cation O an atom that gains one or more electrons and acquires a net negative charg an atom that shares its valence electrons O a molecule that has both positive and negative charges an atom that loses one or more electrons and acquires a net positive charge
![Which particle is indicated by the arrow Hydrogen H Helium He atom proton O electron Lithium Li](https://media.kunduz.com/media/sug-question-candidate/20230201011905602543-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhich particle is indicated by the arrow Hydrogen H Helium He atom proton O electron Lithium Li
![Part A ATP is an unstable high energy molecule that provides body cells with a form of energy that is immediately usable O True O False](https://media.kunduz.com/media/sug-question-candidate/20230201011842309231-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyPart A ATP is an unstable high energy molecule that provides body cells with a form of energy that is immediately usable O True O False
![Which of the following is true about lipids O Lipids found in the cell membrane are composed of one glycerol and three fatty acid chains and are called phospholipids O Lipids that serve as hormones are derived from glycolipids O Lipids used as energy reserves in the body are stored as molecules of phospholipids O Triglycerides are composed of three fatty acids and one glycerol and are stable because they do not dissolve in water](https://media.kunduz.com/media/sug-question-candidate/20230201005420238667-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhich of the following is true about lipids O Lipids found in the cell membrane are composed of one glycerol and three fatty acid chains and are called phospholipids O Lipids that serve as hormones are derived from glycolipids O Lipids used as energy reserves in the body are stored as molecules of phospholipids O Triglycerides are composed of three fatty acids and one glycerol and are stable because they do not dissolve in water
![Water is an important molecule because it O is a poor solvent since few things dissolve in it O can form hydrogen bonds O has a low heat capacity O is non polar](https://media.kunduz.com/media/sug-question-candidate/20230201005335798311-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWater is an important molecule because it O is a poor solvent since few things dissolve in it O can form hydrogen bonds O has a low heat capacity O is non polar
![The pH scale O is based on the concentration of hydrogen ions in a solution O is based on the salinity of a solution O is linear O ranges from 1 to 7](https://media.kunduz.com/media/sug-question-candidate/20230201005256782462-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyThe pH scale O is based on the concentration of hydrogen ions in a solution O is based on the salinity of a solution O is linear O ranges from 1 to 7
![Part A Nonpolar molecules are the result of unequal electron pair sharing O True](https://media.kunduz.com/media/sug-question-candidate/20230201005137665165-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyPart A Nonpolar molecules are the result of unequal electron pair sharing O True
![Part A In a solution the solute is the substance present in the greatest amount True O False](https://media.kunduz.com/media/sug-question-candidate/20230201005034526392-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyPart A In a solution the solute is the substance present in the greatest amount True O False
![Which of the following best describes an isotope a structural variation in which different atoms of the same element have different numbers of neutrons a structural variation in which different atoms of the same element have different numbers of protons O a structural variation in which different atoms of the same element have different numbers of electrons an atom with an unequal number of protons and electrons](https://media.kunduz.com/media/sug-question-candidate/20230201004925022018-4095795.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhich of the following best describes an isotope a structural variation in which different atoms of the same element have different numbers of neutrons a structural variation in which different atoms of the same element have different numbers of protons O a structural variation in which different atoms of the same element have different numbers of electrons an atom with an unequal number of protons and electrons
![Prime Minister William Pitt once said Unlimited power is likely to corrupt the minds of those who possess it In other words power often corrupts those in positions of authority How does this theme apply to George Orwell s book Animal Farm Please respond using the RACES formulate Restate the prompt Answer the prompt Cite evidence Explain evidence and then Summarize Each of those five parts of your response is worth 4 points for a total of 20 points possible](https://media.kunduz.com/media/sug-question-candidate/20230201001929184417-4765194.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyPrime Minister William Pitt once said Unlimited power is likely to corrupt the minds of those who possess it In other words power often corrupts those in positions of authority How does this theme apply to George Orwell s book Animal Farm Please respond using the RACES formulate Restate the prompt Answer the prompt Cite evidence Explain evidence and then Summarize Each of those five parts of your response is worth 4 points for a total of 20 points possible
![What are two signs that Napoleon is not following the Commandment All animals are equal Choose two answers Napoleon and the pigs drink the milk Napoleon works harder than all of the other animals and brags about it Napoleon takes the puppies away from their mothers and secrets them away in order to educate them Napoleon drives Mr Jones off the farm Napoleon looks for ways to improve the farm and the other animals way of life](https://media.kunduz.com/media/sug-question-candidate/20230131234023304217-5353166.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhat are two signs that Napoleon is not following the Commandment All animals are equal Choose two answers Napoleon and the pigs drink the milk Napoleon works harder than all of the other animals and brags about it Napoleon takes the puppies away from their mothers and secrets them away in order to educate them Napoleon drives Mr Jones off the farm Napoleon looks for ways to improve the farm and the other animals way of life
![Provide some historical context of your self selected topic issue related to infant and toddler care Include an explanation of the significance of the topic in the field of early childhood education and more specifically to those that work directly indirectly with infants and toddlers Section 2 Explanation o This section should explain why you selected this topic and how does it connect with your role in the field early childhood education Section 3 Learning Goals o Based on your selected issue topic draft 3 learning goals you would want viewers of your seminar presentation to walk away with note these are just a quick brainstorm of ideas the learning goals objectives will develop over time as you start conducting research](https://media.kunduz.com/media/sug-question-candidate/20230131224147948527-4343810.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyProvide some historical context of your self selected topic issue related to infant and toddler care Include an explanation of the significance of the topic in the field of early childhood education and more specifically to those that work directly indirectly with infants and toddlers Section 2 Explanation o This section should explain why you selected this topic and how does it connect with your role in the field early childhood education Section 3 Learning Goals o Based on your selected issue topic draft 3 learning goals you would want viewers of your seminar presentation to walk away with note these are just a quick brainstorm of ideas the learning goals objectives will develop over time as you start conducting research
![Figure 1 3 AKS Sa3 Which of the following best describes what is occurring in Step 1 of F A Step 1 involves the bacterial plasmid and the gene of interest being cut with enzymes B Step 1 involves the inclusion insertion of the gene of interest within the bac C Step 1 involves both the bacterial plasmid and the gene of interest being cut enzyme D Step 1 involves the inclusion insertion of the bacterial plasmid with the ger 4 AKS 8a3 What is the final result of the process shown in Figure 1 A a DNA mutation B a hybrid C a polyploid D a recombinant DNA 5 AKS 8al Select ALL the advantages of using GMO crops A GMOs allow farmers to grow more crops on less land B GMOs allow farmers to use less pesticide GMOS could lead to new food borne allergies D GMOs often have increased health benefits](https://media.kunduz.com/media/sug-question-candidate/20230131184007551941-5352641.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyFigure 1 3 AKS Sa3 Which of the following best describes what is occurring in Step 1 of F A Step 1 involves the bacterial plasmid and the gene of interest being cut with enzymes B Step 1 involves the inclusion insertion of the gene of interest within the bac C Step 1 involves both the bacterial plasmid and the gene of interest being cut enzyme D Step 1 involves the inclusion insertion of the bacterial plasmid with the ger 4 AKS 8a3 What is the final result of the process shown in Figure 1 A a DNA mutation B a hybrid C a polyploid D a recombinant DNA 5 AKS 8al Select ALL the advantages of using GMO crops A GMOs allow farmers to grow more crops on less land B GMOs allow farmers to use less pesticide GMOS could lead to new food borne allergies D GMOs often have increased health benefits
![Production Possibilities Table This is a model called a production possibilities table To use it correctly we must establish specific rules We will reduce the whole economy to just two commodities potatoes and tractors We will have the economy using the best known technology and utilize the available resources to the fullest in the production of potatoes and tractors Look over the table notice the various combinations then answer the questions Combinations D Potatoes millions of pounds Tractors in thousands A 54 0 B 52 1 C 49 45 2 3 E 40 4 1 At combination B what is the production of potatoes 2 At combination E what is the production of potatoes F 34 5 G 27 6 H 19 7 tractors tractors 3 What happens to the quantity of potatoes as tractor production increases I 10 8 J O 9 4 As the economy moves from producing tractors at combination B to producing tractors at This is the combination C how much change takes place in potato production opportunity cost or the amount of potatoes that must be sacrificed to produce one 1 more unit of tractors cost sacrifice 5 As tractor production moves from combination C to combination D how much change in potato production takes place 6 Increasing tractor production from combination D to combination E changes potato production by what amount 7 If the amount of potato production given up is called cost as the economy moves to increase tractor he made as tractor production moves from B to C from](https://media.kunduz.com/media/sug-question-candidate/20230131032811653454-4412862.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyProduction Possibilities Table This is a model called a production possibilities table To use it correctly we must establish specific rules We will reduce the whole economy to just two commodities potatoes and tractors We will have the economy using the best known technology and utilize the available resources to the fullest in the production of potatoes and tractors Look over the table notice the various combinations then answer the questions Combinations D Potatoes millions of pounds Tractors in thousands A 54 0 B 52 1 C 49 45 2 3 E 40 4 1 At combination B what is the production of potatoes 2 At combination E what is the production of potatoes F 34 5 G 27 6 H 19 7 tractors tractors 3 What happens to the quantity of potatoes as tractor production increases I 10 8 J O 9 4 As the economy moves from producing tractors at combination B to producing tractors at This is the combination C how much change takes place in potato production opportunity cost or the amount of potatoes that must be sacrificed to produce one 1 more unit of tractors cost sacrifice 5 As tractor production moves from combination C to combination D how much change in potato production takes place 6 Increasing tractor production from combination D to combination E changes potato production by what amount 7 If the amount of potato production given up is called cost as the economy moves to increase tractor he made as tractor production moves from B to C from
![Consider the following DNA molecule Assume this is the DNA sequence of an entire chromosomes After replication what will be the sequence of its sister chromatid Explain the reasoning for your answer 4 marks 5 ATATGTACGGTCTTATTTACCCATACCTATT 3 5 3 TATCATGCCAGAATAAATGGGTATGGATAA](https://media.kunduz.com/media/sug-question-candidate/20230130181554141068-4376984.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyConsider the following DNA molecule Assume this is the DNA sequence of an entire chromosomes After replication what will be the sequence of its sister chromatid Explain the reasoning for your answer 4 marks 5 ATATGTACGGTCTTATTTACCCATACCTATT 3 5 3 TATCATGCCAGAATAAATGGGTATGGATAA
![Column I 1 hepatitis 2 cirrhosis 3 cholelithiasis 4 colonic polyposis 5 jaundice 6 inflammatory bowel disease 7 diverticulosis 8 irritable bowel syndrome 9 hepatocellular carcinoma 10 gastroesophageal reflux disease Column II Column II A Yellow orange coloration of the skin and other tissues B Abnormal condition of small pouches or sacs in the wall of the intestine C Ulcerative colitis and Crohn disease D Inflammation of the liver E Abnormal condition of gallstones F Chronic disease of the liver with degeneration of liver cells G Small growths protrude from the mucous membrane lining the intestine H Contents of the stomach flow backwards into the esophagus I Signs and symptoms of GI distress but no lesions found in the GI tract J Primary cancer of the liver](https://media.kunduz.com/media/sug-question-candidate/20230130180933045578-3680634.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyColumn I 1 hepatitis 2 cirrhosis 3 cholelithiasis 4 colonic polyposis 5 jaundice 6 inflammatory bowel disease 7 diverticulosis 8 irritable bowel syndrome 9 hepatocellular carcinoma 10 gastroesophageal reflux disease Column II Column II A Yellow orange coloration of the skin and other tissues B Abnormal condition of small pouches or sacs in the wall of the intestine C Ulcerative colitis and Crohn disease D Inflammation of the liver E Abnormal condition of gallstones F Chronic disease of the liver with degeneration of liver cells G Small growths protrude from the mucous membrane lining the intestine H Contents of the stomach flow backwards into the esophagus I Signs and symptoms of GI distress but no lesions found in the GI tract J Primary cancer of the liver
![descriptions You can tell me what should I look up for each description One description Step outward with your toes while keeping your feet shoulder width apart To push your chest out gently converge your shoulder blades Two description It specifically targets our thighs hamstrings quadriceps and glutes Third description For pushups nothing is utilized here The body s own weight serves as](https://media.kunduz.com/media/sug-question-candidate/20230130171241712699-4384853.jpg?w=256)
Anatomy and Physiology
Introduction to Physiologydescriptions You can tell me what should I look up for each description One description Step outward with your toes while keeping your feet shoulder width apart To push your chest out gently converge your shoulder blades Two description It specifically targets our thighs hamstrings quadriceps and glutes Third description For pushups nothing is utilized here The body s own weight serves as
![Tandem mass spectrometry generated 5 different sizes of fragments that still carry the N terminal tag Fragment 1 579 8 D Frament 2 448 5 D Frament 3 347 4 D Frament 4 218 3 D Frament 5 71 1 D Based on the information provided above determine the sequence of the original oligopeptide and draw its structure What is the](https://media.kunduz.com/media/sug-question-candidate/20230130025700786516-4403546.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyTandem mass spectrometry generated 5 different sizes of fragments that still carry the N terminal tag Fragment 1 579 8 D Frament 2 448 5 D Frament 3 347 4 D Frament 4 218 3 D Frament 5 71 1 D Based on the information provided above determine the sequence of the original oligopeptide and draw its structure What is the
![stion 5 nly two parts a summary and a The best and most effective delivery method is speaking](https://media.kunduz.com/media/sug-question-candidate/20230130021407917192-4655596.jpg?w=256)
Anatomy and Physiology
Introduction to Physiologystion 5 nly two parts a summary and a The best and most effective delivery method is speaking
![Unlike most other legal consumer products ingested into the body cigarettes and other tobacco products Select one O a are under the same strict regulations as alcohol O b are subject to strict product regulation Oc are legal for minors and adults O d are subject to virtually no product regulation](https://media.kunduz.com/media/sug-question-candidate/20230130020816657406-4454594.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyUnlike most other legal consumer products ingested into the body cigarettes and other tobacco products Select one O a are under the same strict regulations as alcohol O b are subject to strict product regulation Oc are legal for minors and adults O d are subject to virtually no product regulation
![Which of the following is the most accurate definition of a system a It is a group of parts that are connected to each other in an additive fashion like A B C Ob It is a group of interdependent parts that together contribute to unified whole or purpose O c It is a group of elements that happen to occupy a similar space and that mimic each other s roles d It is a group of elements that are hierarchically nested with parts at the top dominating functioning](https://media.kunduz.com/media/sug-question-candidate/20230129233557268362-4426144.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyWhich of the following is the most accurate definition of a system a It is a group of parts that are connected to each other in an additive fashion like A B C Ob It is a group of interdependent parts that together contribute to unified whole or purpose O c It is a group of elements that happen to occupy a similar space and that mimic each other s roles d It is a group of elements that are hierarchically nested with parts at the top dominating functioning
![III Define It Part 2 DIRECTIONS Based on what you have learned in this chapter define each of the following in your own words and create a sentence using the word 1 luminous 2 luminary 3 illuminate 4 lucid 5 elucidate hinate 7 pho lucid 6 photon an engery elucidate photon photosynthesis](https://media.kunduz.com/media/sug-question-candidate/20230129192301982999-5347394.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyIII Define It Part 2 DIRECTIONS Based on what you have learned in this chapter define each of the following in your own words and create a sentence using the word 1 luminous 2 luminary 3 illuminate 4 lucid 5 elucidate hinate 7 pho lucid 6 photon an engery elucidate photon photosynthesis
![All adjective suffixes mean pertaining to A True B False Question 5 1 Point A combining form is usually created by adding a o after a root](https://media.kunduz.com/media/sug-question-candidate/20230129035105028590-3319689.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyAll adjective suffixes mean pertaining to A True B False Question 5 1 Point A combining form is usually created by adding a o after a root
![In conditions of dehydration plant cells can increase their water retention by regulating the function of some or all of their aquaporins membrane bound protein channels that allow water to move through the cell membrane via facilitated diffusion Which of the following describes a likely mechanism by which aquaporins can be used to regulate the movement of water across the plant cell membrane A B C D Inhibition of the plant cell Golgi apparatus will decrease the production rate of vesicles and slow down the exocytosis of water molecules Inhibition of ATP hydrolysis will make the aquaporins unable to remove water from the cell and cause more water to remain in the cell Synthesis of additional aquaporins by the plant cell ribosomes will allow the cell to coun teract the movement of water out of the cell Inactivation of aquaporins will make water molecules unable to move across the plant cell membrane and allow more water to remain in the cell](https://media.kunduz.com/media/sug-question-candidate/20230127070322445430-3202034.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyIn conditions of dehydration plant cells can increase their water retention by regulating the function of some or all of their aquaporins membrane bound protein channels that allow water to move through the cell membrane via facilitated diffusion Which of the following describes a likely mechanism by which aquaporins can be used to regulate the movement of water across the plant cell membrane A B C D Inhibition of the plant cell Golgi apparatus will decrease the production rate of vesicles and slow down the exocytosis of water molecules Inhibition of ATP hydrolysis will make the aquaporins unable to remove water from the cell and cause more water to remain in the cell Synthesis of additional aquaporins by the plant cell ribosomes will allow the cell to coun teract the movement of water out of the cell Inactivation of aquaporins will make water molecules unable to move across the plant cell membrane and allow more water to remain in the cell
![Digestive function or role Absorbs water and minerals Stores and concentrates bile Approximately 10 feet in length Manufactures bile Mixes swallowed food with acid and enzymes Actions of Digestive Secretions The breakdown of food into nutrients requires secretions from different organs or glands Many of these secret compounds that break down one or more of the macronutrients Five secretions involved in the digestive process are listed below Choose the macronutrient s that each secre breakdown of Note that some secretions may support the breakdown of more than one macronutrient Secretion Saliva Bile Intestinal juice Organ Gastric juice Pancreatic juice Lipids Proteins Carbohydrates](https://media.kunduz.com/media/sug-question-candidate/20230126232337429463-4870883.jpg?w=256)
Anatomy and Physiology
Introduction to PhysiologyDigestive function or role Absorbs water and minerals Stores and concentrates bile Approximately 10 feet in length Manufactures bile Mixes swallowed food with acid and enzymes Actions of Digestive Secretions The breakdown of food into nutrients requires secretions from different organs or glands Many of these secret compounds that break down one or more of the macronutrients Five secretions involved in the digestive process are listed below Choose the macronutrient s that each secre breakdown of Note that some secretions may support the breakdown of more than one macronutrient Secretion Saliva Bile Intestinal juice Organ Gastric juice Pancreatic juice Lipids Proteins Carbohydrates
![9 The physician has ordered 62 5mcg of Lanoxin The ampule reads 0 25mg mL How many mL should the patient receive mL 10 The physician orders 500mg of ceftazidime IV The label on the 1g vial of ceftazidime reads to reconstitute with 5mL of sterile water How many mL should the nurse give mL 11 A patient with hypomagnesemia has an order for infusion of magnesium sulfate 6 in 250 mL D5W Policy states that the magnesium be infused at a rate of 1 5 gm h How many mL h should the IV pump be programmed for gm diluted](https://media.kunduz.com/media/sug-question-candidate/20230125145404504354-4562113.jpg?w=256)
Anatomy and Physiology
Introduction to Physiology9 The physician has ordered 62 5mcg of Lanoxin The ampule reads 0 25mg mL How many mL should the patient receive mL 10 The physician orders 500mg of ceftazidime IV The label on the 1g vial of ceftazidime reads to reconstitute with 5mL of sterile water How many mL should the nurse give mL 11 A patient with hypomagnesemia has an order for infusion of magnesium sulfate 6 in 250 mL D5W Policy states that the magnesium be infused at a rate of 1 5 gm h How many mL h should the IV pump be programmed for gm diluted