Biomolecules Questions and Answers

You are a researcher investigating the role of the abc gene in tumor formation. You suspect that the abc is expressed in lung cells based on previous research, but the hypothesis has yet to be tested. Even though abc is a known regulator of transcription, you are uncertain what sequence/gene it regulates. Which of the following methods could be used to answer these questions? (i) Create a DNA microarray to see if abc is activated in lung cells. (ii) Make a lung cell lysate and determine the amount of ABC using western blot and use ChIP to select for the DNA sequences that ABC binds. (iii) Use Northern blot to determine the amount of abc RNA present and then western blot to determine the amount of the ABC protein present in the lung cells. (iv) Create labelled lung cell DNA fragments that are potential binding sites of ABC and perform EMSA to determine if it binds.

1. Environmental scientists have become concerned that Maryland's precipitation is too far from neutral to be safe for healthy aquatic ecosystems. What property of water would they test? * pH of water Polarity of water Temperature of water Density of water

If substance A has a specific heat of 50 cal/g °C and substance B has a specific heat 10 cal/g° C, which of these substances would heat up fastest?

What is the purpose of this section of text? A. To contrast how different people used sugar B. To explain sugar cane's ceremonial purpose C. To compare sugar cane use to honey use D. To provide the history of sugar cane use

A zebra mussel is discovered in a lake in Pennsylvania for the first time. Why would this make an ecologist worried? A. Zebra mussels are an invasive species that can completely disrupt an ecosystem. B. Zebra mussols are vulnerable to many predators in that lake. C. Zebra mussels need to live in salt-water environments and it will hurt the organism. D. Zebra mussels need to live in hot-water environments.

The incidence of coronary heart disease is most strongly influenced by the A) Amount of cholesterol consumed. B) Type of fat consumed. C) Amount of fat consumed. D) Type of cholesterol consumed.

The amino acid serine has two ionizable groups: (1) a carboxylic acid group with a pK, of 2.21 and, (2) an amino group with a pK of 9.15. What is the isoelectric point of this amino acid?

Use the following sequence: tgagggctatcctagcgatgcaggttggag a. What does the mRNA strand look like? b. What amino acids does the mRNA strand produce?

How are fatty acids transported to the cells for B-oxidation? A. they are carried by albumin B. they are transported in LDL particles C. they are only degraded in the liver and are not transported D. they are bound to and carried by carnitine E. they are bound to and carried by a CoA molecule

True or False: If you have high cholesterol, the doctor will prescribe the same medication and dosage to all people by using pharmacogenomics. A.)True B.)False

Define 'Enthalpy' A. Energy stored in the movement of molecules in a substance B. The temperature of a molecule C. Energy stored in the chemical bonds in a substance D. The opposite of temperature

All enzymes are upregulated (working as best they can) all the time. True False

Enzymes, which are made of ________ will ________ the activation energy needed for a reaction to occur.

If most chemical reactions are reversible, how do pathways like cellular respiration not run backwards? a) One product is needed before the next reactant is made. b) Enzymes are only active when needed. c) One reactant is needed before the next product is made. d) Enzymes are only produced in certain organelles.

What is the mechanism of action of the antimicrobials commonly known as sulfas (e.g. sulfonamide and trimethoprim)? inhibition of nucleic acids synthesis Inhibition of protein synthesis Injury to the plasma membrane inhibition of metabolic pathway Inhibition of cell wall synthesis

When a protein of interest is tagged with a fluorescent protein like GFP, what feature of this fusion protein must be considered and tested before interpreting any experimental results? List that feature and briefly explain why the researchers would have difficulty interpreting results without consideration of that feature.

Which combination of macromolecule and function is CORRECT? A A nucleic acids: provide structure and support B carbohydrate: provide quick energy for the cell C lipid: speed up chemical reactions D protein: store energy

Some macromolecules are polymers. What is a polymer? a) A solution that consists of many molecules b) A group of elements in matter c) Small molecules that act as building blocks d) A long molecule that consists of repeating units

Amino acids are linked by a specific type of covalent bond. The reaction producing this bond also produces one water molecule. What type of bond links amino acids together in a chain? a) Metallic bonds b) Hydrogen bonds c) Peptide bonds d) lonic bonds

Which of the following best describes the purine riboswitch? Guanine causes RNA to change conformation, producing a transcription terminator structure that removes RNA polymerase. Guanine causes the formation of a stem-loop terminator structure, which is processed by the Dicer to form the RITS. Guanine causes the modification of the RNA polymerase CTD, which results in the premature termination of transcription. Guanine causes the formation of a stem-loop terminator structure, which is processed by the Dicer to form the RISC.

Which ONE of the following has the greatest influence on the metabolic flux of a pathway in a cell? The involvement of an amphibolic intermediate The standard free energy change of a reaction The concentration of product The presence of an enzyme-catalyzed reaction

Explain how information about health risks can be used by someone who has had ancestry DNA testing by a company such as 23 and me or ancestry DNA? For example, is this information something physicians can use to make clinical decisions? What kind of information has the FDA allowed them to provide?

Terry sees an old rusty swing set at the park. He knows that rust is formed when iron (Fe) combines with oxygen (O) in the atmosphere to form iron oxide (FeO). How would you classify iron oxide? compound element mixture solution

Mario uses a hot plate to heat a beaker of 50mL of water. He used a thermometer to measure the temperature of the water. The water in the beaker began to boil when it reached the temperature of 100-C. If Mario completes the same experiment with 25mL of water, what would happen to the boiling point? The water will not reach a boil. The boiling point of water will increase. The boiling point of water will decrease. The boiling point of water will stay the same.

Jamal is combining salt with water in order to determine its solubility. He notices that after adding ten spoonfuls of salt, no more will dissolve into the water. Which statement best explains his observation? * There is not enough solute added to the solution. The solution has reached its saturation point. The density of the salt is being changed. The state of the water is being changed.

Which of the following correctly describes a property of an atom? It has more protons than neutrons. It has a negative or positive charge. It has an equal number of protons and electrons. It has an equal number of neutrons and electrons.

Lithium (Li), Sodium (Na), Potassium (K), Rubidium (Rb), Cesium (Cs), and Francium (Fr) are in the same column in the periodic table. Why are these elements in the same column in the periodic table? A. They have similar properties. B. They have atoms of the same size. C. They have the same number of protons. D. They have the same number of neutrons.

Using your knowledge of lipid structure and properties and any other scientifically reliable online or printed resources, create a 150-word explanation of how different types of dietary fat affect our cardiovascular health. (Hint: Use such key terms as "cholesterol," "HDL," "LDL," and "arteries.") Make sure to use your own words and cite outside sources that you have used.

When a candle is lit, the wick burns, the wax melts, the candle changes shape, and the air around the candle heats up. Which of the following is an example of a chemical change? A. the wick burning B. the wax melting C. the candle changing shape D. the air around the candle heating up

Q6: In the presence of arabinose, glucose affects expression of the ara operon. Record the name of the regulatory mechanism and briefly explain what happens in the presence of low glucose and in the presence of high glucose. Be specific (3 marks)

3. In ~100 words indicate the major sources of fat in your diet and characterize them in terms of healthy and unhealthy. If your fat diet is not "heart-healthy," provide specific recommendations on how to increase your consumption of healthy fats and decrease your consumption of unhealthy fats. Recommend specific foods. Take into account your taste preferences. If your fat diet is mostly "heart-healthy," provide specific recommendations on how to increase the consumption of healthy fats and decrease the consumption of unhealthy fats for a friend or a relative. Take into account that person's taste preferences.

Which of the following enzymes or chemical reagents will not cleave the following polypeptide (amino acids represented by their one letter code)? P-A-N-D-E-M-I-C Trypsin Cyanogen bromide Carboxypeptidase B Chymotrypsin

On a sheet of paper, sketch a picture of a dehydration synthesis reaction between two amino acids. This is not meant to be tricky! Use Fig. 3.18 as a model. Be sure to identify what specific atoms on each amino acid will be involved in the reaction, and be sure and show the solid line that denotes the new covalent bond that will exist in the product. On one of your amino acids, label the amino group, the carboxyl group, and the side chain. Finally, point to and label the peptide bond in the resulting dipeptide. Take a picture of your lovely drawing and upload it here.

When urine is to be cultured for bacteria, the specimen required is: a. preserved b. clean-catch c. random d. first morning e. 24-hour

A group of microbiologists is testing a water sample for level of lead. Test the claim that the water contains level of lead higher than the safe guideline of 15 ppb. a) Identify the claim: Identify null hypothesis: b) Discuss Type I error in the context of the problem. c) Discuss Type II error in the context of the problem. d) Evaluate which error is more serious and advise on the level of significance.

Al(OH)3 (s) + H₂SO4 (aq) → Al2(SO4)3(aq) + H₂O(l) Express your answer as a chemical equation. Identify all of the phases in your answer.

Which statement below about DNA is FALSE? DNA is present in and essential for all living cells. DNA is located in the nucleus of eukaryotic cells. DNA is not always perfectly copied during DNA replication. All DNA molecules in human cells are circular.

One strand of DNA has the sequence 5'-TCCG-3'. What is the sequence of the complementary strand? (Hint: It may help to make a sketch of the complementary strands, including bases and 5'3' labels, before answering!) 5'-TCCG-3' 5'-CGGA-3' 5'-GCCT-3' 5'-AGGC-3'

Which of the following reactions does not release energy? Group of answer choices combining CO2 and water to create glucose metabolizing glucose breaking a phosphate group off of an ATP molecule breaking down cellulose into glucose molecules

Which of the following would be categorised as a disincentive to consumption of sugar-sweetened beverages : Taxing sugar-sweetened beverages Regulating floor and shelf space in supermarkets to limit space taken for sugar-sweetened beverages Mandating that sugar-sweetened beverages must be hidden from sight of consumers (such as placing cigarettes in closed cupboards) All answers given here

What are viral spikes? How do they aid in virulence or infection? How did viral spikes evolve? Describe the viral spike mutations for SARS-CoV2 and how it affects the new strains that are most virulent.

What type(s) of nucleic acid is(are) involved in translation? Hint: Remember that ribosomes are composed of rRNA (ribosomal RNA) and proteins rRNA tRNA and mRNA rRNA, tRNA and mRNA DNA all of the above

Hypertonic (high salt) environment kill most of bacteria... by osmotic lysis by destroying the cell wall by inducing the entrance of water inside the cell by dehydating and shrinking the plasma membrane (plasmolysis) unless the cell wall is intact

List and explain all the components necessary for protein translocation during energy production.

Signal amplification is essential for many signaling pathways, ensuring that a robust response can be induced by even a small amount of ligand. Does amplification occur at these two specific steps during GPCR signaling? Explain why it does or does not occur at each step. • G protein activates adenylyl cyclase. • Protein kinase A activates CREB

A gram positive coccus nonendospore former catalase positive is E. coli Staphylococcus Streptococcus Klebsiella

If the original concentration for a reactant is 0.500 M, what is t1/2 if k is 0.00816 /M* min? 58.7min 7.94 min 84.9 min 245 min

What kind of solid is C12H22O11? lonic Molecular Covalent Network Amorphous Metallic

Which of the following statements about methods of protein sequencing is TRUE? All proteases remove one anino acid at a time from the end of the polypetide chain.Sequencing can be performed on a polypeptide containing disulfide bonds. A single protease is usually all that is needed to determine a sequence. Protein sequencing can be used to determine the tertiary structure of proteins. Edman degradation makes use of a synthetic reagent to break the peptide bond, while protease degradation makes use of biomolecules to break the peptide bond.

The use of food energy to make heat rather than cellular energy is an example of non-shivering thermogenesis. shivering thermogenesis. evaporative cooling. torpor. acclimatization.