Biomolecules Questions and Answers

Biology
BiomoleculesA zebra mussel is discovered in a lake in Pennsylvania for the first time. Why would this make an ecologist worried?
A. Zebra mussels are an invasive species that can completely disrupt an ecosystem.
B. Zebra mussols are vulnerable to many predators in that lake.
C. Zebra mussels need to live in salt-water environments and it will hurt the organism.
D. Zebra mussels need to live in hot-water environments.

Biology
BiomoleculesThe incidence of coronary heart disease is most strongly influenced by the
A) Amount of cholesterol consumed.
B) Type of fat consumed.
C) Amount of fat consumed.
D) Type of cholesterol consumed.

Biology
BiomoleculesThe amino acid serine has two ionizable groups:
(1) a carboxylic acid group with a pK, of 2.21 and,
(2) an amino group with a pK of 9.15. What is the isoelectric point of this amino acid?

Biology
BiomoleculesUse the following sequence:
tgagggctatcctagcgatgcaggttggag
a. What does the mRNA strand look like?
b. What amino acids does the mRNA strand produce?

Biology
BiomoleculesHow are fatty acids transported to the cells for B-oxidation?
A. they are carried by albumin
B. they are transported in LDL particles
C. they are only degraded in the liver and are not transported
D. they are bound to and carried by carnitine
E. they are bound to and carried by a CoA molecule

Biology
BiomoleculesTrue or False: If you have high cholesterol, the doctor will prescribe the same medication and dosage to all people by using pharmacogenomics.
A.)True
B.)False

Biology
BiomoleculesDefine 'Enthalpy'
A. Energy stored in the movement of molecules in a substance
B. The temperature of a molecule
C. Energy stored in the chemical bonds in a substance
D. The opposite of temperature


Biology
BiomoleculesEnzymes, which are made of ________ will ________ the activation energy needed for a reaction to occur.

Biology
BiomoleculesIf most chemical reactions are reversible, how do pathways like cellular respiration not run backwards?
a) One product is needed before the next reactant is made.
b) Enzymes are only active when needed.
c) One reactant is needed before the next product is made.
d) Enzymes are only produced in certain organelles.

Biology
BiomoleculesWhat is the mechanism of action of the antimicrobials commonly known as sulfas (e.g. sulfonamide
and trimethoprim)?
inhibition of nucleic acids synthesis
Inhibition of protein synthesis
Injury to the plasma membrane
inhibition of metabolic pathway
Inhibition of cell wall synthesis

Biology
BiomoleculesWhen a protein of interest is tagged with a fluorescent protein like GFP, what feature of this fusion protein must be considered and tested before interpreting any experimental results? List that feature and briefly explain why the researchers would have difficulty interpreting results without consideration of that feature.

Biology
BiomoleculesWhich combination of macromolecule and function is CORRECT?
A A nucleic acids: provide structure and support
B carbohydrate: provide quick energy for the cell
C lipid: speed up chemical reactions
D protein: store energy

Biology
BiomoleculesSome macromolecules are polymers. What is a polymer?
a) A solution that consists of many molecules
b) A group of elements in matter
c) Small molecules that act as building blocks
d) A long molecule that consists of repeating units

Biology
BiomoleculesAmino acids are linked by a specific type of covalent bond. The reaction producing this bond also produces one water molecule. What type of bond links amino acids together in a chain?
a) Metallic bonds
b) Hydrogen bonds
c) Peptide bonds
d) lonic bonds

Biology
BiomoleculesWhich of the following best describes the purine riboswitch?
Guanine causes RNA to change conformation, producing a transcription terminator structure that removes RNA polymerase.
Guanine causes the formation of a stem-loop terminator structure, which is
processed by the Dicer to form the RITS.
Guanine causes the modification of the RNA polymerase CTD, which results in the
premature termination of transcription.
Guanine causes the formation of a stem-loop terminator structure, which is
processed by the Dicer to form the RISC.

Biology
BiomoleculesWhich ONE of the following has the greatest influence on the metabolic flux of a pathway in a cell?
The involvement of an amphibolic intermediate
The standard free energy change of a reaction
The concentration of product
The presence of an enzyme-catalyzed reaction

Biology
BiomoleculesExplain how information about health risks can be used by someone who has had ancestry DNA testing by a company such as 23 and me or ancestry DNA? For example, is this information something physicians can use to make clinical decisions? What kind of information has the FDA allowed them to provide?

Biology
BiomoleculesTerry sees an old rusty swing set at the park. He knows that rust is formed when iron (Fe) combines with oxygen (O) in the atmosphere to form iron oxide (FeO). How would you classify iron oxide?
compound
element
mixture
solution

Biology
BiomoleculesMario uses a hot plate to heat a beaker of 50mL of water. He used a thermometer to measure the temperature of the water. The water in the beaker began to boil when it reached the temperature of 100-C. If Mario completes the same experiment with 25mL of water, what would happen to the boiling point?
The water will not reach a boil.
The boiling point of water will increase.
The boiling point of water will decrease.
The boiling point of water will stay the same.

Biology
BiomoleculesJamal is combining salt with water in order to determine its solubility. He
notices that after adding ten spoonfuls of salt, no more will dissolve into
the water. Which statement best explains his observation? *
There is not enough solute added to the solution.
The solution has reached its saturation point.
The density of the salt is being changed.
The state of the water is being changed.

Biology
BiomoleculesWhich of the following correctly describes a property of an atom?
It has more protons than neutrons.
It has a negative or positive charge.
It has an equal number of protons and electrons.
It has an equal number of neutrons and electrons.

Biology
BiomoleculesLithium (Li), Sodium (Na), Potassium (K), Rubidium (Rb), Cesium (Cs), and Francium (Fr) are in the same column in the periodic table. Why are these elements in the same column in the periodic table?
A. They have similar properties.
B. They have atoms of the same size.
C. They have the same number of protons.
D. They have the same number of neutrons.

Biology
BiomoleculesUsing your knowledge of lipid structure and properties and any other scientifically reliable online or printed resources, create a 150-word explanation of how different types of dietary fat affect our cardiovascular health. (Hint: Use such key terms as "cholesterol," "HDL," "LDL," and "arteries.") Make sure to use your own words and cite outside sources that you have used.

Biology
BiomoleculesWhen a candle is lit, the wick burns, the wax melts, the candle changes shape, and the air
around the candle heats up. Which of the following is an example of a chemical change?
A. the wick burning
B. the wax melting
C. the candle changing shape
D. the air around the candle heating up

Biology
BiomoleculesQ6: In the presence of arabinose, glucose affects expression of the ara operon. Record the
name of the regulatory mechanism and briefly explain what happens in the presence of low
glucose and in the presence of high glucose. Be specific (3 marks)

Biology
Biomolecules3. In ~100 words indicate the major sources of fat in your diet and characterize
them in terms of healthy and unhealthy.
If your fat diet is not "heart-healthy," provide specific recommendations on
how to increase your consumption of healthy fats and decrease your
consumption of unhealthy fats. Recommend specific foods. Take into account
your taste preferences.
If your fat diet is mostly "heart-healthy," provide specific recommendations on
how to increase the consumption of healthy fats and decrease the consumption
of unhealthy fats for a friend or a relative. Take into account that person's
taste preferences.

Biology
BiomoleculesWhich of the following enzymes or chemical reagents will not cleave the following polypeptide (amino acids represented by their one letter code)?
P-A-N-D-E-M-I-C
Trypsin
Cyanogen bromide
Carboxypeptidase B
Chymotrypsin

Biology
BiomoleculesOn a sheet of paper, sketch a picture of a dehydration synthesis reaction between two amino acids.
This is not meant to be tricky! Use Fig. 3.18 as a model. Be sure to identify what specific atoms on
each amino acid will be involved in the reaction, and be sure and show the solid line that denotes the
new covalent bond that will exist in the product. On one of your amino acids, label the amino group,
the carboxyl group, and the side chain. Finally, point to and label the peptide bond in the resulting
dipeptide. Take a picture of your lovely drawing and upload it here.

Biology
BiomoleculesWhen urine is to be cultured for bacteria, the specimen required is:
a. preserved
b. clean-catch
c. random
d. first morning
e. 24-hour

Biology
BiomoleculesA group of microbiologists is testing a water sample for level of lead. Test the claim that the water
contains level of lead higher than the safe guideline of 15 ppb.
a) Identify the claim:
Identify null hypothesis:
b) Discuss Type I error in the context of the problem.
c) Discuss Type II error in the context of the problem.
d) Evaluate which error is more serious and advise on the level of significance.

Biology
BiomoleculesAl(OH)3 (s) + H₂SO4 (aq) → Al2(SO4)3(aq) + H₂O(l)
Express your answer as a chemical equation. Identify all of the phases in your answer.

Biology
BiomoleculesWhich statement below about DNA is FALSE?
DNA is present in and essential for all living cells.
DNA is located in the nucleus of eukaryotic cells.
DNA is not always perfectly copied during DNA replication.
All DNA molecules in human cells are circular.

Biology
BiomoleculesOne strand of DNA has the sequence 5'-TCCG-3'. What is the sequence of the
complementary strand? (Hint: It may help to make a sketch of the complementary strands,
including bases and 5'3' labels, before answering!)
5'-TCCG-3'
5'-CGGA-3'
5'-GCCT-3'
5'-AGGC-3'

Biology
BiomoleculesWhich of the following reactions does not release energy? Group of answer choices combining CO2 and water to create glucose metabolizing glucose breaking a phosphate group off of an ATP molecule breaking down cellulose into glucose molecules

Biology
BiomoleculesWhich of the following would be categorised as a disincentive to consumption of sugar-sweetened beverages :
Taxing sugar-sweetened beverages
Regulating floor and shelf space in supermarkets to limit space taken for sugar-sweetened beverages
Mandating that sugar-sweetened beverages must be hidden from sight of consumers (such as placing cigarettes in closed cupboards)
All answers given here

Biology
BiomoleculesWhat are viral spikes? How do they aid in virulence or infection? How did viral spikes evolve? Describe the viral spike mutations for SARS-CoV2 and how it affects the new strains that are most virulent.

Biology
BiomoleculesWhat type(s) of nucleic acid is(are) involved in translation?
Hint: Remember that ribosomes are composed of rRNA (ribosomal RNA) and proteins
rRNA
tRNA and mRNA
rRNA, tRNA and mRNA
DNA
all of the above

Biology
BiomoleculesHypertonic (high salt) environment kill most of bacteria...
by osmotic lysis
by destroying the cell wall
by inducing the entrance of water inside the cell
by dehydating and shrinking the plasma membrane (plasmolysis)
unless the cell wall is intact

Biology
BiomoleculesList and explain all the components necessary for protein translocation during energy production.

Biology
BiomoleculesSignal amplification is essential for many signaling pathways, ensuring that a robust response can be induced by even a small amount of ligand. Does amplification occur at these two specific steps during GPCR signaling? Explain why it does or does not occur at each step.
• G protein activates adenylyl cyclase.
• Protein kinase A activates CREB

Biology
BiomoleculesA gram positive coccus nonendospore former catalase positive is
E. coli
Staphylococcus
Streptococcus
Klebsiella

Biology
BiomoleculesIf the original concentration for a reactant is 0.500 M, what is t1/2 if k is 0.00816 /M* min?
58.7min
7.94 min
84.9 min
245 min

Biology
BiomoleculesWhat kind of solid is C12H22O11?
lonic
Molecular
Covalent Network
Amorphous
Metallic

Biology
BiomoleculesWhich of the following statements about methods of protein sequencing is TRUE?
All proteases remove one anino acid at a time from the end of the polypetide chain.Sequencing can be performed on a polypeptide containing disulfide bonds.
A single protease is usually all that is needed to determine a sequence.
Protein sequencing can be used to determine the tertiary structure of proteins.
Edman degradation makes use of a synthetic reagent to break the peptide bond, while
protease degradation makes use of biomolecules to break the peptide bond.

Biology
BiomoleculesThe use of food energy to make heat rather than cellular energy is an example of
non-shivering thermogenesis.
shivering thermogenesis.
evaporative cooling.
torpor.
acclimatization.

Biology
BiomoleculesBiology opinion: is aerobic cellular respiration is simply the reverse of photosynthesis? elaborate reasoning with valid arguments in terms of carbon cycling, electron and energy flow 500 words please type no writing i cannot understand the handwrite

Biology
BiomoleculesDetermine the correct sequence of events during the creation of recombinant
DNA.
1. Plasmid is cut open with enzymes
II. Target gene is cut out with enzymes
III. Plasmid is inserted into the bacterium
IV. Target gene is bonded to the plasmid with Ligase
A. II, I, IV, III
B. I, II, III, IV
C. IV, III, I, II
D. IV, I, II, III

Biology
BiomoleculesWhich of the following is a clinical application of Kirby-Bauer Antibiotic Sensitivity Test?
a. selecting the best chemotherapeutic drug for treating tumors.
b. to reduce the nutritional requirements of harmful bacteria
c. selecting the best antibiotics to treat patients with bacterial infections
d. to directly reduce the incidence of antibiotic resistant bacteria

Biology
BiomoleculesIf a large clear zone is formed around an antibiotic disc placed on an agar plate, inoculated with bacteria. What does this indicate?
a. The bacteria grow in an area on the plate where there were more nutrients.
b. The antibiotics caused the bacteria, immediately around the disc, to mutate.
c. The antibiotics killed the bacteria immediately around the disc.
d. The bacteria is resistant to the antibiotic.