Human Physiology - Chemical Coordination Questions and Answers
![Which of the following statements is NOT true of ATP Acts like an energy shuttle Stores energy obtained from food Consists of adenosine and a tail of 3 phosphate groups Is broken down to AMP and a phosphate group](https://media.kunduz.com/media/sug-question-candidate/20240312181320844384-4754400.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich of the following statements is NOT true of ATP Acts like an energy shuttle Stores energy obtained from food Consists of adenosine and a tail of 3 phosphate groups Is broken down to AMP and a phosphate group
![ces When sodium flows through open voltage gated channels the membrane Multiple Choice O hyperpolarizes repolarizes reaches resting potential](https://media.kunduz.com/media/sug-question-candidate/20240211055446374381-4144409.jpg?w=256)
Biology
Human Physiology - Chemical Coordinationces When sodium flows through open voltage gated channels the membrane Multiple Choice O hyperpolarizes repolarizes reaches resting potential
![How do amino acids like hydroxylysine and thyroxine which are not among the 20 amino acids that are inserted into proteins get into proteins O They are inserted directly O They are the result of the alteration of R groups of the 20 amino acids after their incorporation into the polypeptide O They are the result of the alteration of R groups of the 20 amino acids before their incorporation into the polypeptide O There are more than the 20 amino acids that are said to be inserted into proteins O Their atoms are altered by insertion into the polypeptide QUESTION 8 Proteins are often composed of two or more distinct modules that fold up independently of one another They often represent parts of a protein that function in a semi independent manner These modules are called O protein motifs O functionals O domains dominoes QUESTION 9 When two atoms of the same element bond the electron pairs of the outer shell are equally shared O True](https://media.kunduz.com/media/sug-question-candidate/20240203020802802405-4348260.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationHow do amino acids like hydroxylysine and thyroxine which are not among the 20 amino acids that are inserted into proteins get into proteins O They are inserted directly O They are the result of the alteration of R groups of the 20 amino acids after their incorporation into the polypeptide O They are the result of the alteration of R groups of the 20 amino acids before their incorporation into the polypeptide O There are more than the 20 amino acids that are said to be inserted into proteins O Their atoms are altered by insertion into the polypeptide QUESTION 8 Proteins are often composed of two or more distinct modules that fold up independently of one another They often represent parts of a protein that function in a semi independent manner These modules are called O protein motifs O functionals O domains dominoes QUESTION 9 When two atoms of the same element bond the electron pairs of the outer shell are equally shared O True
![Tathon the skeletal muscle cells in your st energy to continually contract and power your muscles What organele abundant in skeletal muscle cells mitochondria Golgi apparatus smooth endoplasmic reticulum rough endoplasmic reticulum Question 18 1 point Listen fun 1 All of the following are true of ionic bonds EXCEPT Formed between oppositely charged ions the transfer of an electron](https://media.kunduz.com/media/sug-question-candidate/20240201155102515332-4754400.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationTathon the skeletal muscle cells in your st energy to continually contract and power your muscles What organele abundant in skeletal muscle cells mitochondria Golgi apparatus smooth endoplasmic reticulum rough endoplasmic reticulum Question 18 1 point Listen fun 1 All of the following are true of ionic bonds EXCEPT Formed between oppositely charged ions the transfer of an electron
![Steriocelia is found in a O b Inner ear O c O d All answers are correct Epididymis Ductus deferens](https://media.kunduz.com/media/sug-question-candidate/20240116153542703681-6504418.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationSteriocelia is found in a O b Inner ear O c O d All answers are correct Epididymis Ductus deferens
![You flip a coin 5 times and 3 of those are tails Using the binomial probability distribution formula determine the probability of getting tails 3 of the 5 times Reminder You may use a calculator for recitation quizzes P X 0 50 0 3125 0 125 01 n X n X px qn x](https://media.kunduz.com/media/sug-question-candidate/20240115151006045463-6487981.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationYou flip a coin 5 times and 3 of those are tails Using the binomial probability distribution formula determine the probability of getting tails 3 of the 5 times Reminder You may use a calculator for recitation quizzes P X 0 50 0 3125 0 125 01 n X n X px qn x
![Which of the following would be correctly described as a juxtacrine signaling A signal that diffuses over long distances from the producing cell A signal that diffuses over short distances from the producing cell A signal that requires physical contact between cells OA signal that acts on the cell that produces it](https://media.kunduz.com/media/sug-question-candidate/20231203174247400729-4426152.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich of the following would be correctly described as a juxtacrine signaling A signal that diffuses over long distances from the producing cell A signal that diffuses over short distances from the producing cell A signal that requires physical contact between cells OA signal that acts on the cell that produces it
![The vesicles that are anchored to the plasma membrane at a nerve cell presynaptic site are specialized for lysosome secretion polarized secretion constitutive secretion endocytosis](https://media.kunduz.com/media/sug-question-candidate/20231203173744171513-4426152.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationThe vesicles that are anchored to the plasma membrane at a nerve cell presynaptic site are specialized for lysosome secretion polarized secretion constitutive secretion endocytosis
![Q 18 12pt What does rubisco stand for Write out the two primary reactions catalyzed by rubisco including the chemical structures of the reactants and products](https://media.kunduz.com/media/sug-question-candidate/20231121023846419090-5324183.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationQ 18 12pt What does rubisco stand for Write out the two primary reactions catalyzed by rubisco including the chemical structures of the reactants and products
![What type of sensory stimulus provides the afferent arm of the patellar knee Jerk stretch reflex vibration sense from the Pacinian corpuscles linear acceleration from maculae of the utricle and saccule equilibrium sense from proprioceptors in joints stretch of muscle spindles Question 28 1 point Receptors that transmit painful stimuli are also known as O mechanoreceptor Ophotoreceptor nociceptors](https://media.kunduz.com/media/sug-question-candidate/20231115172400128193-5887966.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhat type of sensory stimulus provides the afferent arm of the patellar knee Jerk stretch reflex vibration sense from the Pacinian corpuscles linear acceleration from maculae of the utricle and saccule equilibrium sense from proprioceptors in joints stretch of muscle spindles Question 28 1 point Receptors that transmit painful stimuli are also known as O mechanoreceptor Ophotoreceptor nociceptors
![cell bodies dendrites axons Oaxon terminals Question 18 1 point What types of ganglia can you find in the peripheral nervous system sympathetic ganglia parasympathetic ganglia posterior chain ganglia sensory](https://media.kunduz.com/media/sug-question-candidate/20231115172253050878-5887966.jpg?w=256)
Biology
Human Physiology - Chemical Coordinationcell bodies dendrites axons Oaxon terminals Question 18 1 point What types of ganglia can you find in the peripheral nervous system sympathetic ganglia parasympathetic ganglia posterior chain ganglia sensory
![Most sensory pathways synapse in the basal nuclei Othalamus hypothalamus corpus callosum Question 12 1 point Name the 3 parts of the brain stem cerebrum cerebellum and pons globus pallidus caudate and putamen thalamus hypothalamus and epithalamus medulla oblongata pons and midbrain](https://media.kunduz.com/media/sug-question-candidate/20231115172213270657-5887966.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationMost sensory pathways synapse in the basal nuclei Othalamus hypothalamus corpus callosum Question 12 1 point Name the 3 parts of the brain stem cerebrum cerebellum and pons globus pallidus caudate and putamen thalamus hypothalamus and epithalamus medulla oblongata pons and midbrain
![Which part of the brain is responsible for directing the autonomic nervous system the endocrine system and your sleep wake cycle the cerebellum the limbic system the hypothalamus the frontal lobe Question 14 1 point The corpus callosum is an example of fibers association projection](https://media.kunduz.com/media/sug-question-candidate/20231115172224744523-5887966.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich part of the brain is responsible for directing the autonomic nervous system the endocrine system and your sleep wake cycle the cerebellum the limbic system the hypothalamus the frontal lobe Question 14 1 point The corpus callosum is an example of fibers association projection
![Where do you find the nucleus of a neuron in the cell body in the axon terminals in the axon in the dendrites Question 2 1 point In the Nervous System what does the word tract indicate a collection of cell bodies outside the brain or spinal cord a collection of axons within the brain or spinal cord a collection of cell bodies within the brain or spinal cord a collection of axons outside the brain or spinal cord](https://media.kunduz.com/media/sug-question-candidate/20231115172108830235-5887966.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhere do you find the nucleus of a neuron in the cell body in the axon terminals in the axon in the dendrites Question 2 1 point In the Nervous System what does the word tract indicate a collection of cell bodies outside the brain or spinal cord a collection of axons within the brain or spinal cord a collection of cell bodies within the brain or spinal cord a collection of axons outside the brain or spinal cord
![What type of interaction would you expect between the following groups in a tertiary structure Drag the appropriate items to their respective bins Hydrophobic asparagine and tyrosine Hydrophilic alanine and proline aspartic acid and histidine phenylalanine and isoleucine Salt bridge Hydrogen bond Disulfide bond Reset](https://media.kunduz.com/media/sug-question-candidate/20231115034554024768-5952138.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhat type of interaction would you expect between the following groups in a tertiary structure Drag the appropriate items to their respective bins Hydrophobic asparagine and tyrosine Hydrophilic alanine and proline aspartic acid and histidine phenylalanine and isoleucine Salt bridge Hydrogen bond Disulfide bond Reset
![19 64 Copy Draw the structural formula of each of the following amino acids at pH 11 valine Draw the molecule on the canvas by choosing buttons from the Tools for bonds charges where needed The single bond is active by default DDCOQH 12 CONT Bu H](https://media.kunduz.com/media/sug-question-candidate/20231115034020155612-5952138.jpg?w=256)
Biology
Human Physiology - Chemical Coordination19 64 Copy Draw the structural formula of each of the following amino acids at pH 11 valine Draw the molecule on the canvas by choosing buttons from the Tools for bonds charges where needed The single bond is active by default DDCOQH 12 CONT Bu H
![You have a triglyceride in which the fatty acids are all saturated and each fatty acid is composed of 20 carbon atoms Assuming complete oxidation of the triglyceride which of the following is a good approximation of the amount of ATP produced For convinence we will assume that every NADH H enriches the Proton Motive force enouch to produce 3 ATP while every QH2 FADH2 from Succinate Dehydrogenase produces 2 ATP 56 950 530 495 Fatty acyl CoA A HHO CH CH C C C SCOA a HH acyl CoA dehydrogenase enoyl CoA hydratase 3 L hydroxyacyl CoA 0 Trans A2 enoyl CoA CH CH C C C SCOA 3 L hydroxyacyl CoA dehydrogenase B ketothiolase HHO CH CH C C C SCOA 11 OH H 0 11 CH3 CH C SCOA Fatty acyl CoA B ketoacyl CoA CH3 CH2 C C C FADH H FAD OHO H O NAD NADH H SCOA HSCOA 0 H C C SCOA Acetyl CoA](https://media.kunduz.com/media/sug-question-candidate/20231115031520175919-5917575.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationYou have a triglyceride in which the fatty acids are all saturated and each fatty acid is composed of 20 carbon atoms Assuming complete oxidation of the triglyceride which of the following is a good approximation of the amount of ATP produced For convinence we will assume that every NADH H enriches the Proton Motive force enouch to produce 3 ATP while every QH2 FADH2 from Succinate Dehydrogenase produces 2 ATP 56 950 530 495 Fatty acyl CoA A HHO CH CH C C C SCOA a HH acyl CoA dehydrogenase enoyl CoA hydratase 3 L hydroxyacyl CoA 0 Trans A2 enoyl CoA CH CH C C C SCOA 3 L hydroxyacyl CoA dehydrogenase B ketothiolase HHO CH CH C C C SCOA 11 OH H 0 11 CH3 CH C SCOA Fatty acyl CoA B ketoacyl CoA CH3 CH2 C C C FADH H FAD OHO H O NAD NADH H SCOA HSCOA 0 H C C SCOA Acetyl CoA
![Which of the following reaction types is INCORRECTLY shown a Mineral H mineral 2H SO42 4H H S 4H O Ob Mineral H organic 2CO2 4H CH3COOH 2H O O c Organic H organic Fumarate H succinate d Oxygenic photosynthesis CO2 4H2 CH4 2H O e Aerobic oxidation of H O2 2H 2H O](https://media.kunduz.com/media/sug-question-candidate/20231115032914524434-5917575.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich of the following reaction types is INCORRECTLY shown a Mineral H mineral 2H SO42 4H H S 4H O Ob Mineral H organic 2CO2 4H CH3COOH 2H O O c Organic H organic Fumarate H succinate d Oxygenic photosynthesis CO2 4H2 CH4 2H O e Aerobic oxidation of H O2 2H 2H O
![How do lactic acid and alcohol fermentation differ Select all that apply 50 Lactic acid fermentation produces a 3 carbon molecule and ethanol fermentation produces a 3 carbon compound Lactic acid fermentation produces lactic acid as a byproduct and alcohol fermentation produces ethanol Carbon dioxide is released only during alcohol fermentation Ethanol fermentation produces more ATP than lactic acid fermentation](https://media.kunduz.com/media/sug-question-candidate/20231115023335350734-5904656.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationHow do lactic acid and alcohol fermentation differ Select all that apply 50 Lactic acid fermentation produces a 3 carbon molecule and ethanol fermentation produces a 3 carbon compound Lactic acid fermentation produces lactic acid as a byproduct and alcohol fermentation produces ethanol Carbon dioxide is released only during alcohol fermentation Ethanol fermentation produces more ATP than lactic acid fermentation
![e image above shows a spoonful of glucose powder after it has been ignited by a match This is ne set combustion of glucose in the presence of oxygen ich of the following best describes the respective free energy changes for the one step mbustion of glucose in the presence of oxygen as compared to the multi step oxidation of Cose during cellular respiration assuming both reactions occur under identical conditions The combustion has a higher change in free energy Both reactions have the same change in free energy The combustion has a lower change in free energy](https://media.kunduz.com/media/sug-question-candidate/20231115023156590322-5904656.jpg?w=256)
Biology
Human Physiology - Chemical Coordinatione image above shows a spoonful of glucose powder after it has been ignited by a match This is ne set combustion of glucose in the presence of oxygen ich of the following best describes the respective free energy changes for the one step mbustion of glucose in the presence of oxygen as compared to the multi step oxidation of Cose during cellular respiration assuming both reactions occur under identical conditions The combustion has a higher change in free energy Both reactions have the same change in free energy The combustion has a lower change in free energy
![In the diagram below the red arrows show the flow of energy through the electron transport chain Follow the flow of electrons through the electron transport chain and label the components of the chain Drag the appropriate labels to their respective targets View Available Hint s ATP synthase Coenzyme Q Complex III Complex II Complex IV Cytochrome c Complex I Intermembrane Space Inner Mitochondrial Membrane Mitochondrial Matrix 2H 2H 2H NADH H NAD FADH FAD 2H H O HT Channel 999999 Reset Help](https://media.kunduz.com/media/sug-question-candidate/20231113172338532511-3671786.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationIn the diagram below the red arrows show the flow of energy through the electron transport chain Follow the flow of electrons through the electron transport chain and label the components of the chain Drag the appropriate labels to their respective targets View Available Hint s ATP synthase Coenzyme Q Complex III Complex II Complex IV Cytochrome c Complex I Intermembrane Space Inner Mitochondrial Membrane Mitochondrial Matrix 2H 2H 2H NADH H NAD FADH FAD 2H H O HT Channel 999999 Reset Help
![19 16pts Write out the chemical names chemical structures major reactants and products and enzymes used during glycolysis as 1 molecule of glucose 6 phosphate is converted to 2 molecules of 2 phosphoglycerate Note you only need to provide the chemical structures of any included in the test preview](https://media.kunduz.com/media/sug-question-candidate/20231101013319155333-5324183.jpg?w=256)
Biology
Human Physiology - Chemical Coordination19 16pts Write out the chemical names chemical structures major reactants and products and enzymes used during glycolysis as 1 molecule of glucose 6 phosphate is converted to 2 molecules of 2 phosphoglycerate Note you only need to provide the chemical structures of any included in the test preview
![16 6pts Write out the reactants products and enzyme names for the reactions that release free glucose from glycogen](https://media.kunduz.com/media/sug-question-candidate/20231101013426086800-5324183.jpg?w=256)
Biology
Human Physiology - Chemical Coordination16 6pts Write out the reactants products and enzyme names for the reactions that release free glucose from glycogen
![Which enzyme below is not a primary component of gluconeogenesis O Pyruvate kinase GAP dehydrogenase Glucose 6 phosphatase](https://media.kunduz.com/media/sug-question-candidate/20231101012556232355-5324183.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich enzyme below is not a primary component of gluconeogenesis O Pyruvate kinase GAP dehydrogenase Glucose 6 phosphatase
![son com courseld 12333612 key 13712161221816286609312023 Correctly identify the steps indicated in this diagram for genetic analysis of sorted cell populations Drag the appropriate labels to their respective targets Perform multiple displacement amplification MDA and sequencing Extract DNA Isolate fluorescent cells by flow cytometry PCR Assay for specific genes e g 16S rRNA genes metabolic genes etc Sequence genome DNA A B 5 3 C 3 D 5 Label cells by FISH J Phage DNA Primers polymerase 5](https://media.kunduz.com/media/sug-question-candidate/20231031221747519904-4726552.jpg?w=256)
Biology
Human Physiology - Chemical Coordinationson com courseld 12333612 key 13712161221816286609312023 Correctly identify the steps indicated in this diagram for genetic analysis of sorted cell populations Drag the appropriate labels to their respective targets Perform multiple displacement amplification MDA and sequencing Extract DNA Isolate fluorescent cells by flow cytometry PCR Assay for specific genes e g 16S rRNA genes metabolic genes etc Sequence genome DNA A B 5 3 C 3 D 5 Label cells by FISH J Phage DNA Primers polymerase 5
![Formation of a phosphodiester bond between two nucleotides is energetically unfavorable reaction How is then DNA synthesis driven forward O The phosphodiester bond forms between the 3 hydroxyl of the ribose at the end of the growing chain and the alpha phosphate of the incoming nucleotide A molecule of pyrophosphate PPI is released in the process and is further hydrolyzed into inorganic phosphate P Thus a net of one high energy bond is consumed in the process which drives the process forward PPP 5 DNA 3 OH dNTP PPP 5 DNAn 1 3 OH PPI 2Pi The polymerase is hydrolyzing an ATP molecule the general currency molecule of the cell for every new nucleotide that is added to the growing chain Thus a net of two high energy bonds are consumed in the process which drives the process forward PPP 5 DNA 3 OH dNTP ATP PPP 5 DNAn 1 3 OH PPI 2Pi The phosphodiester bond forms between the 3 hydroxyl of the ribose of the incoming nucleotide and the alpha phosphate at the 5 end of the the growing chain A molecule of pyrophosphate PPI is released in the process and is further hydrolyzed into inorganic phosphate Pi Thus a net of one high energy bond is consumed in the process which drives the process forward dNTP OH PPP 5 DNA 3 OH PPP 5 DNAn 1 3 OH PPI 2Pi](https://media.kunduz.com/media/sug-question-candidate/20231022010111947156-5925010.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationFormation of a phosphodiester bond between two nucleotides is energetically unfavorable reaction How is then DNA synthesis driven forward O The phosphodiester bond forms between the 3 hydroxyl of the ribose at the end of the growing chain and the alpha phosphate of the incoming nucleotide A molecule of pyrophosphate PPI is released in the process and is further hydrolyzed into inorganic phosphate P Thus a net of one high energy bond is consumed in the process which drives the process forward PPP 5 DNA 3 OH dNTP PPP 5 DNAn 1 3 OH PPI 2Pi The polymerase is hydrolyzing an ATP molecule the general currency molecule of the cell for every new nucleotide that is added to the growing chain Thus a net of two high energy bonds are consumed in the process which drives the process forward PPP 5 DNA 3 OH dNTP ATP PPP 5 DNAn 1 3 OH PPI 2Pi The phosphodiester bond forms between the 3 hydroxyl of the ribose of the incoming nucleotide and the alpha phosphate at the 5 end of the the growing chain A molecule of pyrophosphate PPI is released in the process and is further hydrolyzed into inorganic phosphate Pi Thus a net of one high energy bond is consumed in the process which drives the process forward dNTP OH PPP 5 DNA 3 OH PPP 5 DNAn 1 3 OH PPI 2Pi
![D True False Question 30 Our only native cycad in Florida is O None of these apply O Zamia integrifolia O Zamia pumila O Zamia furfuracea Question 31 To what group does Ephedra viridis belong O Ginkgophyta O Coniferophyta O Cycadophyta](https://media.kunduz.com/media/sug-question-candidate/20231020010153784763-4896118.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationD True False Question 30 Our only native cycad in Florida is O None of these apply O Zamia integrifolia O Zamia pumila O Zamia furfuracea Question 31 To what group does Ephedra viridis belong O Ginkgophyta O Coniferophyta O Cycadophyta
![Proteins are made in at the Omitochondria O Lysosome Ribosome](https://media.kunduz.com/media/sug-question-candidate/20231019003346520246-3718919.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationProteins are made in at the Omitochondria O Lysosome Ribosome
![22 23 91 20 19 516 18 Anwar A D A oblique section transverse section C sagittal section D frontal section section is Mustrated by the picture of the brain bolow](https://media.kunduz.com/media/sug-question-candidate/20231006175744091732-4449733.jpg?w=256)
Biology
Human Physiology - Chemical Coordination22 23 91 20 19 516 18 Anwar A D A oblique section transverse section C sagittal section D frontal section section is Mustrated by the picture of the brain bolow
![2 You perform the citrate utilization test and after 48 hours of incubation you make the following observations Should you trus your findings Be sure to explain your reasoning Sample Description E coli E aerogenes Unknown sample 2 Media Color after 48 Hours of Incubation Blue Blue Blue Growth after 48 Hours of Incubation Present Present Present](https://media.kunduz.com/media/sug-question-candidate/20231005020010722843-5485104.jpg?w=256)
Biology
Human Physiology - Chemical Coordination2 You perform the citrate utilization test and after 48 hours of incubation you make the following observations Should you trus your findings Be sure to explain your reasoning Sample Description E coli E aerogenes Unknown sample 2 Media Color after 48 Hours of Incubation Blue Blue Blue Growth after 48 Hours of Incubation Present Present Present
![O is released by the action of the thyroid O regulates blood pressure O has a sequence identical to oxytocin O is a physiologically active dipeptide is a hormone that causes the smooth muscles of the mammary glands to ce](https://media.kunduz.com/media/sug-question-candidate/20231004224935908581-5871217.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationO is released by the action of the thyroid O regulates blood pressure O has a sequence identical to oxytocin O is a physiologically active dipeptide is a hormone that causes the smooth muscles of the mammary glands to ce
![Frequency 0 5 0 4 0 3 0 2 0 Generation 5 1 Allele and Phenotype Frequencies 2 3 Generation 4 5 Red Allele Blue Allele Red Phenotype Purple Phenotype Blue Phenotype](https://media.kunduz.com/media/sug-question-candidate/20231003044727218455-5812129.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationFrequency 0 5 0 4 0 3 0 2 0 Generation 5 1 Allele and Phenotype Frequencies 2 3 Generation 4 5 Red Allele Blue Allele Red Phenotype Purple Phenotype Blue Phenotype
![Bearding in goats is inherited as an autosomal trait determined by two alleles B1 and B2 Interestingly the bearded trait is recessive in females while it is dominant in males In both sexes homozygotes for the B1 allele are beardless Which of the following is true more than one correct answer possible Females with the genotype B2B2 are beardless Females with the genotype B1B1 are bearded Males with the genotype B1B1 are beardless Females with the genotype B1B2 are beardrd Males with the genotype B1B2 are bearded Males with the genotype B2B2 are bearded](https://media.kunduz.com/media/sug-question-candidate/20230923043016920163-5925010.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationBearding in goats is inherited as an autosomal trait determined by two alleles B1 and B2 Interestingly the bearded trait is recessive in females while it is dominant in males In both sexes homozygotes for the B1 allele are beardless Which of the following is true more than one correct answer possible Females with the genotype B2B2 are beardless Females with the genotype B1B1 are bearded Males with the genotype B1B1 are beardless Females with the genotype B1B2 are beardrd Males with the genotype B1B2 are bearded Males with the genotype B2B2 are bearded
![Windshield wipers cannot keep the](https://media.kunduz.com/media/sug-question-candidate/20230916143727015769-5220301.jpg?w=256)
![To improve health in their community healthcare managers and their healthcare organizations HCOS often improve select all that apply Healthcare services O Individual behavior Social environment Physical environment](https://media.kunduz.com/media/sug-question-candidate/20230916043748518425-5663607.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationTo improve health in their community healthcare managers and their healthcare organizations HCOS often improve select all that apply Healthcare services O Individual behavior Social environment Physical environment
![massi i Smeer com](https://media.kunduz.com/media/sug-question-candidate/20230914032027101640-4647329.jpg?w=256)
![Question 1 Most War Points 1 enslaved O welders O lawyers people became after the Civil O sharecroppers](https://media.kunduz.com/media/sug-question-candidate/20230914031226470617-5829358.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationQuestion 1 Most War Points 1 enslaved O welders O lawyers people became after the Civil O sharecroppers
![The property of water that is most responsible for prevention of a rapid rise in body temperature on a hot day is vaporization True O False](https://media.kunduz.com/media/sug-question-candidate/20230914012636404057-3610613.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationThe property of water that is most responsible for prevention of a rapid rise in body temperature on a hot day is vaporization True O False
![Rough endoplasmic reticulum X Nucleus Chloroplast X Golgi apparatus Cell membrane X Mitochondrion X Central vacuole Cell wall Cytoplasm](https://media.kunduz.com/media/sug-question-candidate/20230912003847046374-4832772.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationRough endoplasmic reticulum X Nucleus Chloroplast X Golgi apparatus Cell membrane X Mitochondrion X Central vacuole Cell wall Cytoplasm
![8 8 1 A neutral oxygen atom atomic number 8 has 8 electrons located in 2 different electron orbitals True 2 Hydrogen has only one neutron and no protons in its nucleus False 8 3 An atom consists of a central nucleus surrounded by electrons that are in constant motion True 4 Almost all of the mass of an atom is concentrated in its electrons False 8 5 The orbital of an electron is the volume of space where the electron is most likely to be found True 6 Almost all of the volume of an atom is empty space True 8 7 The reactivity or chemical behavior of an atom depends primarily on the number of neutrons it has Click to select B 8 Modern physics indicates that we cannot determine the exact location of a particular electron at any given time Click to select 9 Electrons are maintained in their orbitals by their attraction to the positively charged nucleus Click to select B 10 Atomic orbitals represent probability distributions for electrons and come in a variety of shapes Click to select](https://media.kunduz.com/media/sug-question-candidate/20230908174941665890-4144409.jpg?w=256)
Biology
Human Physiology - Chemical Coordination8 8 1 A neutral oxygen atom atomic number 8 has 8 electrons located in 2 different electron orbitals True 2 Hydrogen has only one neutron and no protons in its nucleus False 8 3 An atom consists of a central nucleus surrounded by electrons that are in constant motion True 4 Almost all of the mass of an atom is concentrated in its electrons False 8 5 The orbital of an electron is the volume of space where the electron is most likely to be found True 6 Almost all of the volume of an atom is empty space True 8 7 The reactivity or chemical behavior of an atom depends primarily on the number of neutrons it has Click to select B 8 Modern physics indicates that we cannot determine the exact location of a particular electron at any given time Click to select 9 Electrons are maintained in their orbitals by their attraction to the positively charged nucleus Click to select B 10 Atomic orbitals represent probability distributions for electrons and come in a variety of shapes Click to select
![Which of the following is a synapomorphy of most but not all animal phyla multicelluar they have neurons they are heterotrophs they move under their own power at some point in their life cycle 1 point Which of these isn t a feature of bilaterian animals differentiating them from other animals they are triploblasts they exhibit cephalization they have the property of being divisible into symmetrical halves on either side of only a single plane they are diploblasts](https://media.kunduz.com/media/sug-question-candidate/20230901044818379429-5611724.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich of the following is a synapomorphy of most but not all animal phyla multicelluar they have neurons they are heterotrophs they move under their own power at some point in their life cycle 1 point Which of these isn t a feature of bilaterian animals differentiating them from other animals they are triploblasts they exhibit cephalization they have the property of being divisible into symmetrical halves on either side of only a single plane they are diploblasts
![oints 3 In the story One of These Days why is the line Now you ll pay for our twenty dead men so important It was a lower wisdom tooth The dentist spread his feet and grasped the tooth with the hot forceps The Mayor seized the arms of the chair braced his feet with all his strength and felt an icy void in his kidneys but didn t make a sound The dentist moved only his wrist Without rancor rather with a bitter tenderness he said Now you ll pay for our twenty dead men The Mayor felt the crunch of bones in his jaw and his eyes filled with tears But he didn t breathe until he felt the tooth come out Then he saw it through his tears It seemed so foreign to his pain that he failed to understand his torture of the five previous nights O It is not important O It provides context and explains why the dentist dislikes the mayor O It provides context and explains why the mayor dislikes the dentist Que 25 17 21 29 33 13 1 5 9](https://media.kunduz.com/media/sug-question-candidate/20230829161120347304-5816702.jpg?w=256)
Biology
Human Physiology - Chemical Coordinationoints 3 In the story One of These Days why is the line Now you ll pay for our twenty dead men so important It was a lower wisdom tooth The dentist spread his feet and grasped the tooth with the hot forceps The Mayor seized the arms of the chair braced his feet with all his strength and felt an icy void in his kidneys but didn t make a sound The dentist moved only his wrist Without rancor rather with a bitter tenderness he said Now you ll pay for our twenty dead men The Mayor felt the crunch of bones in his jaw and his eyes filled with tears But he didn t breathe until he felt the tooth come out Then he saw it through his tears It seemed so foreign to his pain that he failed to understand his torture of the five previous nights O It is not important O It provides context and explains why the dentist dislikes the mayor O It provides context and explains why the mayor dislikes the dentist Que 25 17 21 29 33 13 1 5 9
![A rat poison called Warfarin has been widely used in many cities including New York since the early 1950s Warfarin inhibits blood coagulation A gene called VKORC1 is involved in the vitamin K reductase pathway which is involved in blood coagulation Animals homozygous for the VKORC1 allele are susceptible to poisoning by Warfarin Animals homozygous for the vkorc1 allele are resistant to the poison but have low survival rates because they cannot produce enough vitamin K Heterozygotes are intermediate in terms of warfarin susceptibility and vitamin K production Over time and exposure to Warfarin in New York the vkorc1 allele has increased in frequency but never to the exclusion of the VKORC1 allele What is being described in this scenario O Positive selection the vkorc1 allele has been selected for in New York O Negative selection the VKORC1 allele has been selected against in New York O Balancing selection the heterozygote has the highest fitness](https://media.kunduz.com/media/sug-question-candidate/20230828182254436373-3636637.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationA rat poison called Warfarin has been widely used in many cities including New York since the early 1950s Warfarin inhibits blood coagulation A gene called VKORC1 is involved in the vitamin K reductase pathway which is involved in blood coagulation Animals homozygous for the VKORC1 allele are susceptible to poisoning by Warfarin Animals homozygous for the vkorc1 allele are resistant to the poison but have low survival rates because they cannot produce enough vitamin K Heterozygotes are intermediate in terms of warfarin susceptibility and vitamin K production Over time and exposure to Warfarin in New York the vkorc1 allele has increased in frequency but never to the exclusion of the VKORC1 allele What is being described in this scenario O Positive selection the vkorc1 allele has been selected for in New York O Negative selection the VKORC1 allele has been selected against in New York O Balancing selection the heterozygote has the highest fitness
![came during the O Potsdam Conference O Yalta Conference O signing of Treaty of Versailles signing of Treaty of Paris Previous 00 00 00 00 Grade Results inc 2005 2023](https://media.kunduz.com/media/sug-question-candidate/20230824041036558119-5816702.jpg?w=256)
Biology
Human Physiology - Chemical Coordinationcame during the O Potsdam Conference O Yalta Conference O signing of Treaty of Versailles signing of Treaty of Paris Previous 00 00 00 00 Grade Results inc 2005 2023
![A protease is O An An enzyme that degrades DNA An enzyme that synthesizes RNA An enzyme that degrades proteins An enzyme synthesizes proteins](https://media.kunduz.com/media/sug-question-candidate/20230823021050681636-4123275.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationA protease is O An An enzyme that degrades DNA An enzyme that synthesizes RNA An enzyme that degrades proteins An enzyme synthesizes proteins
![Which of the following BEST completes the diagram Enacted to make the United States Army comparable to European Armies Authorized the growth of the federal army and National Guard O The Selective Service Act O The National Army Expansion Act The Service Expansion Act The National Guard Service Act Created an increased need for weapons](https://media.kunduz.com/media/sug-question-candidate/20230812011934172489-5816702.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationWhich of the following BEST completes the diagram Enacted to make the United States Army comparable to European Armies Authorized the growth of the federal army and National Guard O The Selective Service Act O The National Army Expansion Act The Service Expansion Act The National Guard Service Act Created an increased need for weapons
![Below is a graphic that shows ways in which a mutation may influence the sequence of nucleotides in a gene and the structure of an associated protein Choose the correct answer from the drop down box No mutation AB CD EF McGraw Hill Education 3 CACGTGGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTAGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTGGAGTGAGGTCACCTC Val His Leu Thr Pro Wall Glu m CACGTGGAGTGAGGTATC CTC Val His Leu Thr Pro Stop 5](https://media.kunduz.com/media/sug-question-candidate/20230802061111327882-5799832.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationBelow is a graphic that shows ways in which a mutation may influence the sequence of nucleotides in a gene and the structure of an associated protein Choose the correct answer from the drop down box No mutation AB CD EF McGraw Hill Education 3 CACGTGGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTAGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTGGAGTGAGGTCACCTC Val His Leu Thr Pro Wall Glu m CACGTGGAGTGAGGTATC CTC Val His Leu Thr Pro Stop 5
![The far point of vision is the distance beyond which no change in lens shape needed for focusing the distance at which you can see most clearly the furthest distance that you can see clearly the closest point on which the eye can focus](https://media.kunduz.com/media/sug-question-candidate/20230725214502016232-4426144.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationThe far point of vision is the distance beyond which no change in lens shape needed for focusing the distance at which you can see most clearly the furthest distance that you can see clearly the closest point on which the eye can focus
![Jestion 22 1 point Listen Hormones that promote homeostasis O travel to target cells without passage in the plasma are not found as members of antagonistic signaling mechanisms utilize receptors that bind any hormone usually operate as part of a negative feedback system Cignal transduction in the target cell without binding to receptors](https://media.kunduz.com/media/sug-question-candidate/20230725015332370859-5765857.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationJestion 22 1 point Listen Hormones that promote homeostasis O travel to target cells without passage in the plasma are not found as members of antagonistic signaling mechanisms utilize receptors that bind any hormone usually operate as part of a negative feedback system Cignal transduction in the target cell without binding to receptors
![21 Listen Antidiuretic hormone ADH functions at the cellular level by triggering the synthesis of an enzyme that makes the phospholipid bilayer more permeable to water 23 24 causing membranes to include more phospholipids that have unsaturated fatty acids causing an increase in the number of aquaporin molecules of collecting duct cells O decreasing the speed at which filtrate flows through the nephron leading to increased reabsorption of water stimulating the reabsorption of glucose through channel proteins](https://media.kunduz.com/media/sug-question-candidate/20230725015209521501-4838748.jpg?w=256)
Biology
Human Physiology - Chemical Coordination21 Listen Antidiuretic hormone ADH functions at the cellular level by triggering the synthesis of an enzyme that makes the phospholipid bilayer more permeable to water 23 24 causing membranes to include more phospholipids that have unsaturated fatty acids causing an increase in the number of aquaporin molecules of collecting duct cells O decreasing the speed at which filtrate flows through the nephron leading to increased reabsorption of water stimulating the reabsorption of glucose through channel proteins