Ecology - Biodiversity & Conservation Questions and Answers

hich of the following is an example of sustainable development resource management A B C D Clear cutting forests that results in deforestation Over fishing that results in population declines and possible extinction of fish species Harvest reduction that slows the harvesting of deep water species that grow slowly allowing them more time to replenish population numb Hunting of already endangered species driving the population numbers toward extinction
Biology
Ecology - Biodiversity & Conservation
hich of the following is an example of sustainable development resource management A B C D Clear cutting forests that results in deforestation Over fishing that results in population declines and possible extinction of fish species Harvest reduction that slows the harvesting of deep water species that grow slowly allowing them more time to replenish population numb Hunting of already endangered species driving the population numbers toward extinction
Which best describes a species whose protection means a wide range of other species with also be protected A B D Umbrella species Endangered Species Extinct Species Invasive Species
Biology
Ecology - Biodiversity & Conservation
Which best describes a species whose protection means a wide range of other species with also be protected A B D Umbrella species Endangered Species Extinct Species Invasive Species
A chimpanzee a human a gibbon and old world monkeys all share O a 2 1 2 3 dental formula O tails O large body sizes O 5 cusps on their lower second molars
Biology
Ecology - Biodiversity & Conservation
A chimpanzee a human a gibbon and old world monkeys all share O a 2 1 2 3 dental formula O tails O large body sizes O 5 cusps on their lower second molars
The Endangered Species Act was passed in 1973 but many people today feel that endangered Species Act has not done enough to protect endangered species from human impacts Do you think that it needs to be updated
Biology
Ecology - Biodiversity & Conservation
The Endangered Species Act was passed in 1973 but many people today feel that endangered Species Act has not done enough to protect endangered species from human impacts Do you think that it needs to be updated
omplete the table 2 3 4 5 6 8 Enzyme that unwinds DNA Sections of copied DNA created on the lagging strand The strand that is copied in a continuous way Binds Okazaki fragments Builds a new DNA strand by adding complementary bases Stabilizes the DNA molecule during replication Strand that is copied discontinuously Initiates the synthesis DNA by creating a short RNA segment
Biology
Ecology - Biodiversity & Conservation
omplete the table 2 3 4 5 6 8 Enzyme that unwinds DNA Sections of copied DNA created on the lagging strand The strand that is copied in a continuous way Binds Okazaki fragments Builds a new DNA strand by adding complementary bases Stabilizes the DNA molecule during replication Strand that is copied discontinuously Initiates the synthesis DNA by creating a short RNA segment
Listen Which of the following is true of the DNA double helix a Adenine complements cytosine Ob Only major grooves can be formed Oc The strands are parallel d Guanine complements thymine e Phosphate groups are located at the 5 ends of both strands
Biology
Ecology - Biodiversity & Conservation
Listen Which of the following is true of the DNA double helix a Adenine complements cytosine Ob Only major grooves can be formed Oc The strands are parallel d Guanine complements thymine e Phosphate groups are located at the 5 ends of both strands
Question 9 When a cell secretes a growth factor that binds to receptors onits own membrane preventing it fromproliferating this is an example of endocrine signaling autocrine signaling O paracrine signaling 0 5 pts contact dependent signaling direct intercellular signaling
Biology
Ecology - Biodiversity & Conservation
Question 9 When a cell secretes a growth factor that binds to receptors onits own membrane preventing it fromproliferating this is an example of endocrine signaling autocrine signaling O paracrine signaling 0 5 pts contact dependent signaling direct intercellular signaling
gene consists of the entire molecule sequence required for synthesis of a n or a n
Biology
Ecology - Biodiversity & Conservation
gene consists of the entire molecule sequence required for synthesis of a n or a n
A difference between a chicken s foot and a duck s foot is the presence or absence of webbing a duck s foot has webbing between the digits while a chicken s foot lacks the webbing Which of the cell processes that play a role in producing tissues organs is NOT happening to a great extent during development of a duck s foot differentiation O cell connections cell growth O apoptosis 0 5 P Ocell division
Biology
Ecology - Biodiversity & Conservation
A difference between a chicken s foot and a duck s foot is the presence or absence of webbing a duck s foot has webbing between the digits while a chicken s foot lacks the webbing Which of the cell processes that play a role in producing tissues organs is NOT happening to a great extent during development of a duck s foot differentiation O cell connections cell growth O apoptosis 0 5 P Ocell division
Gap junctions in animal cells are most similar to inplant cells O hemidesmosomes O plasmodesmata O primary cell walls O tight junctions middle lamella
Biology
Ecology - Biodiversity & Conservation
Gap junctions in animal cells are most similar to inplant cells O hemidesmosomes O plasmodesmata O primary cell walls O tight junctions middle lamella
Question 10 When epidermal growth factor binds to its O enzyme linked receptor O mechanoreceptor O G protein coupled receptor O ligand gated ion channel receptor Othermoreceptor 0 5 pts the receptor phosphorylates itself triggering a signal transduction pathway
Biology
Ecology - Biodiversity & Conservation
Question 10 When epidermal growth factor binds to its O enzyme linked receptor O mechanoreceptor O G protein coupled receptor O ligand gated ion channel receptor Othermoreceptor 0 5 pts the receptor phosphorylates itself triggering a signal transduction pathway
S AHCCS Website Resources Innovation Academy Match each part of speech with its correct definition Column A 1 2 3 4 5 6 7 8 A person place thing or idea a word that takes the place of a noun Column A a word that expresses an action or a state of being a word that describes a noun or pronoun a word or phrase that modifies changes a verb or adjective words that join words or groups of words words that show the relationship between a noun or pronoun with others words in the sentence words that describe an emotion through some of kind of exclamation Question 2 8 points Match the words to the correct part of speech Column B a adverb b conjunction c pronoun d adjective e verb f interjection g noun h preposition Column B
Biology
Ecology - Biodiversity & Conservation
S AHCCS Website Resources Innovation Academy Match each part of speech with its correct definition Column A 1 2 3 4 5 6 7 8 A person place thing or idea a word that takes the place of a noun Column A a word that expresses an action or a state of being a word that describes a noun or pronoun a word or phrase that modifies changes a verb or adjective words that join words or groups of words words that show the relationship between a noun or pronoun with others words in the sentence words that describe an emotion through some of kind of exclamation Question 2 8 points Match the words to the correct part of speech Column B a adverb b conjunction c pronoun d adjective e verb f interjection g noun h preposition Column B
Seed Abundance g m2 B 12 Daphne All Edible Species Rese 4 4 1975 1976 I 1977 I 1978 1 Figure 3 Changes in Geospiza fortis population and seed abundance on Daphne major before and after the drought of 1977 Grant 1986 Your assignment Using the Grants Finch Study Data covering the period from before to after the drought of 1976 77 Identify the specific data that supports the claim that the Grants documented natural selection in action Explain how the Grants data supports the occurrence of natural selection of the medium ground finches on Daphne Major Be sure to connect the science that you have been learning about selection to the evidence you collected from the data to reason the claim Other questions to consider include How do you know that finches beak depth is heritable How did the finch population change from before the drought to after Why do you think the average beak depth of the birds increased
Biology
Ecology - Biodiversity & Conservation
Seed Abundance g m2 B 12 Daphne All Edible Species Rese 4 4 1975 1976 I 1977 I 1978 1 Figure 3 Changes in Geospiza fortis population and seed abundance on Daphne major before and after the drought of 1977 Grant 1986 Your assignment Using the Grants Finch Study Data covering the period from before to after the drought of 1976 77 Identify the specific data that supports the claim that the Grants documented natural selection in action Explain how the Grants data supports the occurrence of natural selection of the medium ground finches on Daphne Major Be sure to connect the science that you have been learning about selection to the evidence you collected from the data to reason the claim Other questions to consider include How do you know that finches beak depth is heritable How did the finch population change from before the drought to after Why do you think the average beak depth of the birds increased
The following excerpt comes from the article Microbial Biodegradation of Toxic Waste Bioremediation by Sarah Moore News Medical Life Sciences May 17 2021 E Is this an example of in situ or ex situ bioremediation Interestingly while there are no other natural organisms that downgrade mercury there are several that transform it into a more dangerous substance known as methylmercury Often at industrial sites ionic or elemental mercury is discharged and converted into methylmercury by microbes which then accumulates in the environment and enters the food chain The genetically modified bacteria developed by the team at the Inter American University of Puerto Rico could address this issue by degrading the mercury discharged at such sites before it is converted into methylmercury To achieve this the team is developing a method of adding their modified bacteria into water filters at industrial sites to remove the mercury from the water before it enters the surrounding environment Ex situ In situ
Biology
Ecology - Biodiversity & Conservation
The following excerpt comes from the article Microbial Biodegradation of Toxic Waste Bioremediation by Sarah Moore News Medical Life Sciences May 17 2021 E Is this an example of in situ or ex situ bioremediation Interestingly while there are no other natural organisms that downgrade mercury there are several that transform it into a more dangerous substance known as methylmercury Often at industrial sites ionic or elemental mercury is discharged and converted into methylmercury by microbes which then accumulates in the environment and enters the food chain The genetically modified bacteria developed by the team at the Inter American University of Puerto Rico could address this issue by degrading the mercury discharged at such sites before it is converted into methylmercury To achieve this the team is developing a method of adding their modified bacteria into water filters at industrial sites to remove the mercury from the water before it enters the surrounding environment Ex situ In situ
Based on the diagram what is decomposition Which processes add CO into the atmosphere Which processes take CO out of the atmosphere Which of these processes are humans directly responsible for
Biology
Ecology - Biodiversity & Conservation
Based on the diagram what is decomposition Which processes add CO into the atmosphere Which processes take CO out of the atmosphere Which of these processes are humans directly responsible for
someplace you ve lived before Your answer How was this lesson Please be honest Awful the worst 1 O 2 O 3 O 4 5 O Amazing the best WAZI
Biology
Ecology - Biodiversity & Conservation
someplace you ve lived before Your answer How was this lesson Please be honest Awful the worst 1 O 2 O 3 O 4 5 O Amazing the best WAZI
graphs show the relationship between the weekly sea surface temperature anomalies WSSTA and coral cover during two twelve month periods 1998 99 and 2002 03 which were the warmest in the six year study Each dot represents one studied reef 80 Coral cover 60 40 20 0 5 O 8 Coral cover 80 60 40 20 0 O 0 O 10 15 20 25 30 35 1998 1999 2002 2003 Weekly sea surface temperature anomalies WSSTA c i Compare and contrast the data for 1998 1999 and 2002 2003 2 5 00 10 15
Biology
Ecology - Biodiversity & Conservation
graphs show the relationship between the weekly sea surface temperature anomalies WSSTA and coral cover during two twelve month periods 1998 99 and 2002 03 which were the warmest in the six year study Each dot represents one studied reef 80 Coral cover 60 40 20 0 5 O 8 Coral cover 80 60 40 20 0 O 0 O 10 15 20 25 30 35 1998 1999 2002 2003 Weekly sea surface temperature anomalies WSSTA c i Compare and contrast the data for 1998 1999 and 2002 2003 2 5 00 10 15
In order to reuse an enzyme after the conclusion of an enzyme catalyzed reaction what must occur O the enzyme has to be resynthesized O the enzyme has to separate itself from the product O changes into an active form O the enzyme has to decrease entropy QUESTION 8 You are studying an enzyme catalyzed reaction that induces a particular cellular activity in the lab If you wanted to slow down that particular cellular activity by controlling the enzyme what could you do O Decrease the temperature of the incubator where the cells are growing O Increase the pH of the media the cells are growing in to the optimum pH O Add cofactors to the media the cells are growing in O Add an allosteric activator to the cells QUESTION 9
Biology
Ecology - Biodiversity & Conservation
In order to reuse an enzyme after the conclusion of an enzyme catalyzed reaction what must occur O the enzyme has to be resynthesized O the enzyme has to separate itself from the product O changes into an active form O the enzyme has to decrease entropy QUESTION 8 You are studying an enzyme catalyzed reaction that induces a particular cellular activity in the lab If you wanted to slow down that particular cellular activity by controlling the enzyme what could you do O Decrease the temperature of the incubator where the cells are growing O Increase the pH of the media the cells are growing in to the optimum pH O Add cofactors to the media the cells are growing in O Add an allosteric activator to the cells QUESTION 9
Each of the following is fermentation products except acetyl CoA lactate propionate OO ethanol Question 10 0 5 points Listen Why are mitochondria so prevalent in skeletal muscle Mitochondria provide the muscle elasticity to contract More mitochondria are required in tissues where blood flow is restricted Mitochondria provide energy for muscle contraction
Biology
Ecology - Biodiversity & Conservation
Each of the following is fermentation products except acetyl CoA lactate propionate OO ethanol Question 10 0 5 points Listen Why are mitochondria so prevalent in skeletal muscle Mitochondria provide the muscle elasticity to contract More mitochondria are required in tissues where blood flow is restricted Mitochondria provide energy for muscle contraction
Owas isolated from an ancient meoterite sample found in Australia is a virus that infects other viruses O is the first virus found to replicate outside of a host cell O is hypothesized to be the ancestor to all other viruses Question 4 Icosahedral capsids are only found in Giant viruses because the complexity of the capsid requires a minimum of 80 genes to constru O True False Question 5 The coccolithovirus can cause algal blooms by infecting and ultimately killing the primary competitors of marine algae
Biology
Ecology - Biodiversity & Conservation
Owas isolated from an ancient meoterite sample found in Australia is a virus that infects other viruses O is the first virus found to replicate outside of a host cell O is hypothesized to be the ancestor to all other viruses Question 4 Icosahedral capsids are only found in Giant viruses because the complexity of the capsid requires a minimum of 80 genes to constru O True False Question 5 The coccolithovirus can cause algal blooms by infecting and ultimately killing the primary competitors of marine algae
You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall
Biology
Ecology - Biodiversity & Conservation
You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall
5 Which of the following are unlikely to grow on Simmons citrate agar Select all that apply a E coli b S flexneri c A bacterium that requires an inorganic nitrogen source d A bacterium that lacks citrate permease e E aerogenes 21
Biology
Ecology - Biodiversity & Conservation
5 Which of the following are unlikely to grow on Simmons citrate agar Select all that apply a E coli b S flexneri c A bacterium that requires an inorganic nitrogen source d A bacterium that lacks citrate permease e E aerogenes 21
31 Which of the following is a inverse PCR method A using primers with 1 bp change to generate mutations no B using primers with restriction enzyme sequences adapter on the 5 end using primers that sequence outwards to obtain upstream and downstream sequence none of the above D
Biology
Ecology - Biodiversity & Conservation
31 Which of the following is a inverse PCR method A using primers with 1 bp change to generate mutations no B using primers with restriction enzyme sequences adapter on the 5 end using primers that sequence outwards to obtain upstream and downstream sequence none of the above D
PREDICTION 0 Atmosphere no 02 more CO2 Earliest 2 1 F Atmosphere more 02 less COZI ON B Haceral Cell Prokaryote Multicellutar Plant Energy Competition Chemoautotrophie Anaerobic Bacteria 3 Multicellular Animal Ocean of Molecules 12 AHME RNA 4 A 5 H C Cyanobacteria M sen 6 7 D GD H 1 Organic molecules N Prediction Provide a justification for your group s sequence of events HISTORY OF LIFE ON EARTH 8 H L E Unicellular Eukaryote 9 J Big Bang How did you know which cards to place first S the beginning BID bang What is the reason you placed the cards on the latest end Bis the latest beca 10 I 11 up you will first make a prediction about the sequence of events by placing the environment and organism cards along the timeline poster provided by the teacher Place earlier events on the left hand side of the timeline and later events on the right hand side Provide a justification for your choices in the space below 3 12 13 JE of the anivers e 14 Latest 15 F 3 Animal is Latest new to the world ar Which cards are you most uncertain about their placement everything comes First then s What questions do you now have
Biology
Ecology - Biodiversity & Conservation
PREDICTION 0 Atmosphere no 02 more CO2 Earliest 2 1 F Atmosphere more 02 less COZI ON B Haceral Cell Prokaryote Multicellutar Plant Energy Competition Chemoautotrophie Anaerobic Bacteria 3 Multicellular Animal Ocean of Molecules 12 AHME RNA 4 A 5 H C Cyanobacteria M sen 6 7 D GD H 1 Organic molecules N Prediction Provide a justification for your group s sequence of events HISTORY OF LIFE ON EARTH 8 H L E Unicellular Eukaryote 9 J Big Bang How did you know which cards to place first S the beginning BID bang What is the reason you placed the cards on the latest end Bis the latest beca 10 I 11 up you will first make a prediction about the sequence of events by placing the environment and organism cards along the timeline poster provided by the teacher Place earlier events on the left hand side of the timeline and later events on the right hand side Provide a justification for your choices in the space below 3 12 13 JE of the anivers e 14 Latest 15 F 3 Animal is Latest new to the world ar Which cards are you most uncertain about their placement everything comes First then s What questions do you now have
Was the Columbian Exchange
Biology
Ecology - Biodiversity & Conservation
Was the Columbian Exchange
DNA Replication Labeling with word bank DNA polymerase 5 DNA Ligase Okazaki fragment DNA Primase Single Strand Binding Leading Strand Lagging Proteins Strand 5 3 Helicase RNA primer OTTY Mys Ox 3 5 Topoisomerase
Biology
Ecology - Biodiversity & Conservation
DNA Replication Labeling with word bank DNA polymerase 5 DNA Ligase Okazaki fragment DNA Primase Single Strand Binding Leading Strand Lagging Proteins Strand 5 3 Helicase RNA primer OTTY Mys Ox 3 5 Topoisomerase
Cellular respiratio Oxygen in CO Oxidative phosphorylation trix Inner mitochondrial membrane Matrix Recreate the order of the flow of electrons through oxidative phosphorylation from the electron donor to the terminal acceptor Start by clicking the first item in the sequence or dragging it here Drag the items below into the box above in the correct order starting with the first item in the sequence Electrons are donated to oxygen Protein complexes accept electrons and also pump protons across the mitochondrial membrane
Biology
Ecology - Biodiversity & Conservation
Cellular respiratio Oxygen in CO Oxidative phosphorylation trix Inner mitochondrial membrane Matrix Recreate the order of the flow of electrons through oxidative phosphorylation from the electron donor to the terminal acceptor Start by clicking the first item in the sequence or dragging it here Drag the items below into the box above in the correct order starting with the first item in the sequence Electrons are donated to oxygen Protein complexes accept electrons and also pump protons across the mitochondrial membrane
11 Anyone that is at least sixteen years old that is employed or that is actively looking for a job A person that has given up looking for a job Is when people change jobs or looking for their first 12 13 job 14 The percentage of people that are in the labor force who want to work but can t find a job 15 When people become unemployed because they lack certain skills or education The supply and demand of jobs in the economy 16
Biology
Ecology - Biodiversity & Conservation
11 Anyone that is at least sixteen years old that is employed or that is actively looking for a job A person that has given up looking for a job Is when people change jobs or looking for their first 12 13 job 14 The percentage of people that are in the labor force who want to work but can t find a job 15 When people become unemployed because they lack certain skills or education The supply and demand of jobs in the economy 16
Which of the following is NOT one of the 4 basic elements of all living things Hydrogen Oxygen Carbon Potassium Question 9 1 point
Biology
Ecology - Biodiversity & Conservation
Which of the following is NOT one of the 4 basic elements of all living things Hydrogen Oxygen Carbon Potassium Question 9 1 point
https commons wikimedia org wiki File TransOceanus TedicuitC CE gr2 png a Toda Macrobia century trade and communications made this an early example of which of the following choices Choose the BEST answer increased O A trade route O Global integration Transportation of goods and services
Biology
Ecology - Biodiversity & Conservation
https commons wikimedia org wiki File TransOceanus TedicuitC CE gr2 png a Toda Macrobia century trade and communications made this an early example of which of the following choices Choose the BEST answer increased O A trade route O Global integration Transportation of goods and services
A sponge has the following only cells no tissues Ono gut cavity a blastocoel a coelom Da blastopore is formed during development Question 41 1 point Listen Arthropods have metameres and a bilateral body symmetry O True False
Biology
Ecology - Biodiversity & Conservation
A sponge has the following only cells no tissues Ono gut cavity a blastocoel a coelom Da blastopore is formed during development Question 41 1 point Listen Arthropods have metameres and a bilateral body symmetry O True False
altitude it is covered with snow What is the central idea of this paragraph O Everest is always covered with snow Mount Everest is the highest peak in the world The altitude of Mount Everest is not significant Mount Everest can be measured
Biology
Ecology - Biodiversity & Conservation
altitude it is covered with snow What is the central idea of this paragraph O Everest is always covered with snow Mount Everest is the highest peak in the world The altitude of Mount Everest is not significant Mount Everest can be measured
Which figure of speech is used in the phrase Cute as a bug Metaphor O Simile O Personification Hyperbole
Biology
Ecology - Biodiversity & Conservation
Which figure of speech is used in the phrase Cute as a bug Metaphor O Simile O Personification Hyperbole
Identify the figure of speech used in the expression He is a tiger in the boxing ring O Idiom O Metaphor O Hyperbole
Biology
Ecology - Biodiversity & Conservation
Identify the figure of speech used in the expression He is a tiger in the boxing ring O Idiom O Metaphor O Hyperbole
What is onomatopoeia It is the representation of a place event literary work myth or work of art either directly or by implication It is an expression peculiar to a particular language that means something different from the literal meaning of the words It refers to words that imitate the sound they denote It is the fallacy of attributing inanimate O human feelings to
Biology
Ecology - Biodiversity & Conservation
What is onomatopoeia It is the representation of a place event literary work myth or work of art either directly or by implication It is an expression peculiar to a particular language that means something different from the literal meaning of the words It refers to words that imitate the sound they denote It is the fallacy of attributing inanimate O human feelings to
What does a cakewalk mean in the sentence below Last year the match was a cakewalk for her but this year I believe there is stiff competition O Easy O Tough O Walking cake
Biology
Ecology - Biodiversity & Conservation
What does a cakewalk mean in the sentence below Last year the match was a cakewalk for her but this year I believe there is stiff competition O Easy O Tough O Walking cake
volume of forgotten lore While I nodded nearly napping suddenly there came a tapping As of some one gently rapping rapping at my chamber door Tis some visitor I muttered tapping at my chamber door more Only this and nothing Find the figure of speech used in the lines above O Personification O Metaphor O Alliteration
Biology
Ecology - Biodiversity & Conservation
volume of forgotten lore While I nodded nearly napping suddenly there came a tapping As of some one gently rapping rapping at my chamber door Tis some visitor I muttered tapping at my chamber door more Only this and nothing Find the figure of speech used in the lines above O Personification O Metaphor O Alliteration
Select all that apply Choose all general assumptions made by scientists The universe s fundamental properties have not changed since its inceptio All natural forces acting now have always acted The fundamental nature of the Universe is in constant flux The Universe can never be completely described 1 1 O
Biology
Ecology - Biodiversity & Conservation
Select all that apply Choose all general assumptions made by scientists The universe s fundamental properties have not changed since its inceptio All natural forces acting now have always acted The fundamental nature of the Universe is in constant flux The Universe can never be completely described 1 1 O
Choose the correct answer In Greek dramas the role of the O protagonist O antagonist O confidant O None of the choices was awarded to the best actor
Biology
Ecology - Biodiversity & Conservation
Choose the correct answer In Greek dramas the role of the O protagonist O antagonist O confidant O None of the choices was awarded to the best actor
Which of the following is NOT a belief of Transcendentalists O Everything in the world is a reflection of the divine soul O Intuition gives one an understanding of right and wrong O Having personal belongings is more important than having other things O The natural world is a doorway to the spiritual world
Biology
Ecology - Biodiversity & Conservation
Which of the following is NOT a belief of Transcendentalists O Everything in the world is a reflection of the divine soul O Intuition gives one an understanding of right and wrong O Having personal belongings is more important than having other things O The natural world is a doorway to the spiritual world
Question 64 Choose the correct answer to complete the statement A simile is Points 1 O an exaggeration or overstatement O a comparison of two unlike things a statement with restraint to emphasize what is being talked about O a term for an often repeated idea or theme in literature
Biology
Ecology - Biodiversity & Conservation
Question 64 Choose the correct answer to complete the statement A simile is Points 1 O an exaggeration or overstatement O a comparison of two unlike things a statement with restraint to emphasize what is being talked about O a term for an often repeated idea or theme in literature
Why is this a bad example of the visual strategy Mutualism is a biological interaction between two species wherein both the species benefit from each other O The definition is incorrect The picture is not unexpected or funny so you won t really remember it The image came from google
Biology
Ecology - Biodiversity & Conservation
Why is this a bad example of the visual strategy Mutualism is a biological interaction between two species wherein both the species benefit from each other O The definition is incorrect The picture is not unexpected or funny so you won t really remember it The image came from google
Why do you think the title of Achebe s novel is Things Fall Apart The novel describes the end of harvest season The novel describes the O breakdown of a man and his society The novel describes a natural disaster All of the choices
Biology
Ecology - Biodiversity & Conservation
Why do you think the title of Achebe s novel is Things Fall Apart The novel describes the end of harvest season The novel describes the O breakdown of a man and his society The novel describes a natural disaster All of the choices
What was the purpose of the passage of the Title IX Act Ensure that there is no discrimination in women s collegiate athletes O Avoid discrimination is based on race on college campuses O Avoid discrimination based on age of collegiate O Avoid discrimination based on class
Biology
Ecology - Biodiversity & Conservation
What was the purpose of the passage of the Title IX Act Ensure that there is no discrimination in women s collegiate athletes O Avoid discrimination is based on race on college campuses O Avoid discrimination based on age of collegiate O Avoid discrimination based on class
People also ask What is the importance of gender equity
Biology
Ecology - Biodiversity & Conservation
People also ask What is the importance of gender equity
What was the hardest part of the experience for poor immigrants crossing the Atlantic Ocean O Traveling in steerage O Being homesick Being forced to do hard labor O Leaving their families in their home countries Questic 1 5 9 13 17 21
Biology
Ecology - Biodiversity & Conservation
What was the hardest part of the experience for poor immigrants crossing the Atlantic Ocean O Traveling in steerage O Being homesick Being forced to do hard labor O Leaving their families in their home countries Questic 1 5 9 13 17 21
Question 3 Points 1 Also known as the Unequal Treaties this protocol was signed with China after the failure of the Boxer Rebellion Chinese Protocol Boxer Protocol Eastern Protocol O Unequal Protocol Complete Later Complete Reset Reset butte this assess Reset Questions 9
Biology
Ecology - Biodiversity & Conservation
Question 3 Points 1 Also known as the Unequal Treaties this protocol was signed with China after the failure of the Boxer Rebellion Chinese Protocol Boxer Protocol Eastern Protocol O Unequal Protocol Complete Later Complete Reset Reset butte this assess Reset Questions 9
The repuration daytoy were hoch They were The Gruppe were are that the army was bases d OUS e disband may forever 6
Biology
Ecology - Biodiversity & Conservation
The repuration daytoy were hoch They were The Gruppe were are that the army was bases d OUS e disband may forever 6
Question 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The speciation of squirrel populations separated by a geographic barrier C The extinction of a species of eucalyptus tree due to forest fires D Slow changes to a habitat that cause divergence in forest populations SUBMIT
Biology
Ecology - Biodiversity & Conservation
Question 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The speciation of squirrel populations separated by a geographic barrier C The extinction of a species of eucalyptus tree due to forest fires D Slow changes to a habitat that cause divergence in forest populations SUBMIT
Match the tissue type with its function protection from wear and tear supports and binds other tissues can act as a water reservoir filtration and exchange of substances via diffusion absorption and secretion withstand high tension and stretching particularly in one direction 1 Simple squamous epithelium 2 Simple columnar epithelium 3 Stratified squamous epithelium 4 Dense regular connective tissue 5 Areolar connective tissue
Biology
Ecology - Biodiversity & Conservation
Match the tissue type with its function protection from wear and tear supports and binds other tissues can act as a water reservoir filtration and exchange of substances via diffusion absorption and secretion withstand high tension and stretching particularly in one direction 1 Simple squamous epithelium 2 Simple columnar epithelium 3 Stratified squamous epithelium 4 Dense regular connective tissue 5 Areolar connective tissue