Anatomy of Flowering Plants Questions and Answers

Biology
Anatomy of Flowering PlantsWhich of the following are the effects of urbanization in the late 19th century I Increased congestion II People were forced to live in tenements III Increased incidence of disease IV People were allowed to live in big apartments O II and III O I and II O I II and IV O I II and II

Biology
Anatomy of Flowering PlantsThe main reason for the depressed state of agriculture in the United States in the 1920 s was O Rapid industrialization Availability of cheap land for farming Completed interstate highway system Relaxation of immigration laws

Biology
Anatomy of Flowering PlantsWhich of the following is NOT true of political machines They led to corruption in the cities led They many improvements within the cities to The gave birth to the Democratic Party aftor They became less important

Biology
Anatomy of Flowering Plants13 Air dry the pellets for 10 min to evaporate remaining isopropanol 14 Add 400 L of ethanol to each tube the air dried pellets 15 Mix by inverting the tubes several times and leave at room temperature for 3 min 16 Place the tubes in a balanced microcentrifuge and spin for 5 min at 14 000 rpms Align tubes in the rotor with the cap hinges pointing outward Nucleic acids will collect on the tube side under the hinge during centrifugation 17 Carefully pour off the supernatant from each tube and then completely remove the remaining liquid with a micropipette set at 100 L 18 Air dry the pellets for 10 min to evaporate remaining ethanol 19 Add 100 L of TE RNase A buffer to each tube Dissolve the nucleic acid pellet by pipetting in and out Take care to wash down the side of the tube underneath the hinge where the pellet formed during centrifugation 20 Incubate TE RNAse A buffer and DNA mixture at room temperature for 5 min 21 Microcentrifuge the tubes for 1 min at 12 000 rpms to pellet any material that did not go into the solution 22 DNA may be used immediately or stored at 20 C until you are ready to continue with the amplification of the DNA Keep the DNA on ice as you proceed Edward s Buffer dH O 1 M Tris pH 8 0 5 M NaCl 0 5 M EDTA 10 SDS TE RNAse A Buffer dH O 0 01 M Tris pH 8 0 2 mM EDTA RNase A dissolved in glacial acetic

Biology
Anatomy of Flowering PlantsQuestion 7 Points 1 The first president to benefit from instant popularity by appearing on TV to promote himself in commercials was Adlai Stevenson O Dwight Eisenhower O Storm Thurmond O Harry Truman

Biology
Anatomy of Flowering PlantsMolarity M is measured in what units mol mL L mol O g L Omol L Question 8 1 point Listen Match the following terms to the appropriate definition Molar concentration of H in solution liquid dissolving solute solid being dissolved 1 Solute 2 Solvent 3 Concentration 4 pH

Biology
Anatomy of Flowering PlantsQuestion 9 Points 1 Choose the correct answer In September O Japan O Yugoslavia O US O Soviet Union joined the Rome Berlin Axis

Biology
Anatomy of Flowering PlantsHow many people were expected by the organizers of Woodstock How many actually attended O 120 000 more than 400 000 O 50 000 more than 120 000 O 120 000 more than 2 million O 50 000 more than 400 000 O Re Res this Que 1 5 a

Biology
Anatomy of Flowering Plants72 Go Review Conceptual Example 8 as background for this problem A loudspeaker is generating sound in a room At a certain point the sound waves coming directly from the speaker without reflecting from the walls create an intensity level of 75 0 dB The waves reflected from the walls create by themselves an intensity level of 72 0 dB at the same point What is the total intensity level Hint The answer is not 147 0 dB bove

Biology
Anatomy of Flowering PlantsGeneral McAuliffe made a heroic stand at the Belgian town of Bastogne to help win the Battle of in which the Germans lost irreplaceable machinery and troops O the Bulge O Berlin O Belgium Bastogne Res Rese this Ques 1 R 5

Biology
Anatomy of Flowering PlantsOne form of cystic fibrosis is caused by a mutation in the middle of the DNA sequence of the CFTR gene If you look at the protein produced from this mutated sequence and the protein is the normal length what type s of mutation is most likely O Nonsense Missense O Frameshift

Biology
Anatomy of Flowering PlantsSelect all that apply A missense point mutation can Oshorten protein length Odisrupt protein function Odisrupt protein folding O have no effect on protein folding or function Ocause a disease phenotype

Biology
Anatomy of Flowering PlantsQuestion 6 Points 1 The candidates for the presidential election of 1932 were Benjamin Harris and Andrew Jackson Richard Nixon and John F Kennedy O Franklin D Roosevelt and Herbert Hoover O Harry Truman and Franklin Roosevelt

Biology
Anatomy of Flowering PlantsChoose the correct answer are overcrowded areas of a city in which the housing is typically in very bad condition Slums O Apartments O Business districts O Ghettos 1 5 9 13 17 21

Biology
Anatomy of Flowering Plantswas an informal way of discriminating against African Americans I regulated rules and customs between whites and African Americans What am 17 O Segregation O Jim Crow Laws O Racial etiquette O Grandfather clause Questions 5 6 9 13 17 21 2 10 14 18 22

Biology
Anatomy of Flowering Plantsuestion 8 ho was the first woman to swim the English Channel Annette Kellerman O Suzanne Lenglen O Gertrude Ederle Sally Dal

Biology
Anatomy of Flowering PlantsQuestion 5 Points 2 What shifted the balance of power in Europe in the 1860s The aggressive expansion of Russia The rumor that France may intervene in the American Civil War O The unifications of Italy and Germany O Great Britain s policy of isolationism

Biology
Anatomy of Flowering PlantsRead the following passage All the cotton must be manured and enough fertilizer must be brought to manure each crop highly the croppers to pay for one half of all manure bought the quantity to be purchased for each crop must be left to me Based on the passage and your own knowledge this passage is an excerpt from a O sharecroppers contract O slave contract O Freedmen s Bureau landowner contract O a Jim Crow law Complete Later Complete Rese Reset this ap Quest 1 5 Re 9

Biology
Anatomy of Flowering PlantsQuestion 9 Points 1 What restrictions were imposed by the Southern states in an effort to prevent African Americans from voting O They had to have a passport O They had to own land O They had to have a check up They had to pass a literacy test pay the poll tax and or be eligible for the grandfather clause Complete Later Complete Reset Reset butt this assess Reset Question 5 9

Biology
Anatomy of Flowering PlantsWhat did the implementation of Jim Crow Laws mean for African Americans in the South O Fair treatment and accommodations brought economic educational and social stability O Jim Crow laws guaranteed constitutional protections to freed men and women Inferior treatment brought economic educational and social disadvantages to African Americans O Slavery was enacted through these laws Res Rese this Ques 1 F 5

Biology
Anatomy of Flowering PlantsQuestion 10 immigrants joined the Union Army in large numbers O Irish Points 1 O Danish O European O German

Biology
Anatomy of Flowering PlantsRead the following and answer the question The peak year of European immigration was in 1907 when 1 285 349 persons entered the country By 1910 13 5 million immigrants were living in the United States In 1921 Congress passed the Emergency Quota Act followed by the Immigration Act of 1924 The 1924 Act was aimed at further restricting the Southern and Eastern Europeans especially Jews Italians and Slavs who had begun to enter the country in large numbers beginning in the 1890s Most of the European refugees fleeing the Nazis and World War II were barred from coming to the United States How did the Congress restrict immigrants from Southern and Eastern Europe By passing the Page Act of 1875 By charging expensive fees at Ellis Island O By passing the Immigration Act of 1924 igrants to pass literacy tests

Biology
Anatomy of Flowering PlantsWhy did Addams volunteer as an on call doctor O Because she had medical training O Because she wanted to become popular Because she wanted to earn money O Because there weren t enough real doctors available

Biology
Anatomy of Flowering PlantsAll of the following is true of the Populist Party EXCEPT O They favored the unlimited coinage of silver to increase the money supply They wanted public ownership of railroads by the U S government They fought for an 8 hour day for industrial workers O They favored a regressive income tax

Biology
Anatomy of Flowering PlantsBelow is a primary spermatocyte in metaphase I of meiosis The chromosomes have already replicated and lined up as shown along the metaphase plate for this particular meiotic event In each case alleles of a gene are shown for each chromosome A a and F f What are the possible genotypes of the sperm once both phases of meiosis are complete AAlaa XX ff FF XX O Aa Ff O Af aF O AF af O AF Af aF af

Biology
Anatomy of Flowering PlantsLabel the chromosomes indicated with the dotted lines or brackets in the cell below Maternal chromosome 1 0 XX Paternal chromosome 1 Replicated chromosome Homologous chromosomes Sister chromatid

Biology
Anatomy of Flowering PlantsHow will you make up 50 mL of buffer A 0 1 M NaCl 0 01M MgCl2 40mM DTT starting with the following stock solutions 1 M NaCl 0 5M MgCl2 1 TT

Biology
Anatomy of Flowering PlantsThe sun generates energy through nuclear fusion What is nuclear fusion O Small atoms bond to form a heavy atom Atoms are broken down into small atoms O Atoms are changed into bombs

Biology
Anatomy of Flowering PlantsQuestion 6 Points 1 is an act of any sovereign power granting a general pardon for a past offense to a person or group Amnesty A pardon Naturalization O A reprisal

Biology
Anatomy of Flowering PlantsQuestion 10 Points 2 In their plans for Reconstruction both President Abraham Lincoln and President Andrew Johnson sought to allow the Southern States to reenter the nation as quickly as possible O punish the South for starting the Civil War O force the Southern States to pay reparations to the Federal Government O establish the Republican Party as the only political party in the South

Biology
Anatomy of Flowering PlantsQuestion 48 Points 1 Which is the most popular night club in Harlem during the 1920 s O Club 54 O The Cotton Club Smalls Jazz Club O The Marquee

Biology
Anatomy of Flowering PlantsQuestion 44 Identify the country where the Boxer Rebellion unfolded O Japan Points 1 O England O Nicaragua O China

Biology
Anatomy of Flowering PlantsChoose the correct answer is a popular music style of the early 1900s that originated among African Americans in New Orleans in the late 19th century and is characterized by syncopated rhythms and improvisation O Scat O Blues O Jazz O Bluegrass

Biology
Anatomy of Flowering PlantsPoints 1 Effort to improve efficiency in the workplace by applying scientific principles to make tasks simpler and easier is called O Interchangeable Parts O Scentiffic Management O Scientific Method Complette Latter

Biology
Anatomy of Flowering PlantsProtecting social welfare Goals of the Progressive Movement Improving efficiency Which of the following BEST completes the diagram Combating racial discrimination and creating economic reform O Creating economic reform and encouraging public spending Promoting moral reform and creating economi

Biology
Anatomy of Flowering PlantsQuestion 20 Points 2 The main reason for the depressed state of agriculture in the United States in the 1920 s was O Rapid industrialization O Availability of cheap land for farming O Completed interstate highway system Relaxation of immigration laws Complete Later Complete

Biology
Anatomy of Flowering PlantsRead the following passage Bitter complaints have come in from countless places citing the provocative behavior of Jews a certain amount of conspiratorial planning was involved To prevent vigorous defensive action by the Aryan people we have no choice but to contain the problem through legislative measures Adolph Hitler Hitler s words were spoken before the Reichstag in Nuremberg before the Nazis adopted the Nuremberg Laws which was a set of laws that systemized anti Semitism These types of laws may be compared to in the United States O Dred Scott laws O Jim Crow laws the Fugitive Slave Act O the platform of the Ku Klux Klan 2 25 33 37

Biology
Anatomy of Flowering PlantsStudy the following table 1910 After 1900 1881 1924 1882 Year O A C D B O C D B A OD B A C Choice OB C D A Which of the following answer choices shows the correct matching order of the Choice column from top to bottom Event A Congress passed the Chinese Exclusion Act B Marked the high point of Italian immigration to the United States C Many Danish immigrants were Mormon converts who moved to Utah D Two million Jews fled the pogroms organized attacks of the Russian Empire 17 21 25 29 33 1 22 26 30 34

Biology
Anatomy of Flowering PlantsRead the following and answer the question Immigration patterns of the 1930s were dominated by the Great Depression which hit the U S hard and lasted over ten years In the final prosperous year 1929 there were 279 678 immigrants recorded but in 1933 only 23 068 came to the U S In the early 1930s more people emigrated from the United States than immigrated to it The U S government sponsored a Mexican Repatriation program which was intended to encourage people to voluntarily move to Mexico However thousands were deported against their will Altogether about 400 000 Mexicans were repatriated What event led to the repatriation of close to half a million Mexican immigrants O The United State Right to Work Act of 1930 O World War II The Great Depression The Immigration Act of 1924

Biology
Anatomy of Flowering PlantsQuestion 17 Points 3 Which production system is mentioned in this graphical representation Production of large number of items The assembly line was then devised by the manufacturers O Division of labor All manufactured parts were assembled in one place O Primitive communism O Mass production Division of labor use of interchgeable parts and assembly line played a vital role Feudal mode of production


Biology
Anatomy of Flowering Plants8 A In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 plate LB LB AMP LB AMP ARA Explanation Plasmid Growth 100 white colonies 100 white colonies Plasmid Growth No growth No growth

Biology
Anatomy of Flowering PlantsB In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 Plate B LB AMP B AMP ARA Explanation Plasmid Growth No growth No growth Plasmid Growth No growth No growth

Biology
Anatomy of Flowering PlantsThe mutant coding DNA strand 5 GGCCATGACAGAGGAGAAAAAGTTATTGCT 3 Write the mRNA sequence for this patient Write it 5 to 3 but only include the letters in the sequence ex ACGG in your answer Type your answer and submit 22 X X 5 CCGGUACUGUCUCCUCUUUUUUCAAUAACGAC 3 Hint coquence X

Biology
Anatomy of Flowering Plants21 Listen Trees are not usually found in the tundra biome because of extreme winter temperatures Opermafrost insufficient annual precipitation acidic soils overbrowsing by musk ox and caribou

Biology
Anatomy of Flowering Plantshat is the difference between a community and an ecosystem A commuity is larger than an ecosystem An ecosystem includes only abiotic factors O An ecosystem is a community plus the physical environment of that are Communities contain only one species whereas pr species

Biology
Anatomy of Flowering Plantserent body cells can respond differently to the same peptide hormones because Oa target cell s response is determined by the components of its signal transduction pathways the circulatory system regulates responses to hormones by routing the hormones to specific targets different target cells have different sets of genes O each cell converts that hormone to a different metabolite the hormone is chemically altered in different ways as it travels thr circulatory system

Biology
Anatomy of Flowering PlantsChange of seasons is caused by Ochanges in wind patterns change in the distance of the Earth from the sun Ovariations in the output of solar energy the tilt of the Earth gravitational pull of the sun and the moon O

Biology
Anatomy of Flowering Plantswo plant species live in the same biome but on different continents Although the wo species are not at all closely related they may appear quite similar as a result of convergent evolution Omigration Ogene flow Oparallel evolution allopatric speciation

Biology
Anatomy of Flowering PlantsFive 3 examples of laws and or government actions that have helped to preserve natural habitats and protect resources Briefly explain each