The Living World Questions and Answers

Biology
The Living WorldWhat are the potential ecological impacts of wind power Select all that may apply Disruption of scenery Wind turbines cause cancer Risk of injury death to birds and bats Noise produced by the rotor blades They will increase storms


Biology
The Living World43 Describe antigenic variation and how Trypanosoma uses this to cause disease

Biology
The Living WorldDescribe the pathogenic mechanisms of the two E coli pathovars EHEC and EPEC Discuss how the spreading of pathogenic E coli from its main reservoir can be reduced

Biology
The Living WorldC A U 5 TACAGCTATGTAATTCTGTAACAT 31 3 AUG UCG AVA CAV VAA GAC AVV GUA S S AUG UVA CAG AAV VAC AUA GCU GUA 3 B What would be the sequence of the protein produced if this mRNA were translated in an E coli cell 4 pts N Met Leu Gin ASn Tyr Ile Ala val C C Can the C terminal residue be substituted with an alanine residue by changing just a single nucleotide in the mRNA Why or why not 2 pts GUA GCA 3 yes by substiting Cytosine for Val Ala First letter of codon 5 end Second letter of codon U C G UUU Phe UCU Ser UAU Tyr UGU Cys UUC Phe UCC Ser UAC Tyr UGC Cys UUA Leu UCA Ser UUG Leu UCG Ser CUU Leu CCU CUC Leu CCC CUA Leu CCA CUG Leu CCG AUU AUC AUA lle ACU lle ACC A UAA Stop UGA Stop UAG Stop UGG Trp Pro CAU Pro CAC Pro CAA Pro CAG His CGU His CGC Arg Arg Gln CGA Arg Gin CGG Arg Thr AAU Asn AGU Ser Thr AAC Asn AGC Ser lle ACA Thr AAA Lys AGA Arg ACC

Biology
The Living WorldWhat is the BEST word to describe the television programming that Montag sees on the walls SELECT AN ANSWER O depressing O peaceful O chaotic joyful

Biology
The Living WorldRead each statement below and determine which type of market structure it is describing Write PC for Pure Competition MC for Monopolistic Competition O for Oligopoly or M for Monopoly 1 Coke and Pepsi heavily dominate the soda market and rarely advertise their prices J 2 In the US the market for beef is heavily regulated and all most all beef producers across the country produce beef practically identically 3 Sonic exists in a market where they must advertise their differences in addition to their prices 4 In Atlanta the market for Zoo s is dominated by the Atlanta Zoo 5 It Atlanta the market for tourist entertainment sees competition from a few large competitors including the Zoo World of Coke the Aquarium and Sports teams 6 In the market for novels there are thousands of writers in similar genres but each writer tries to make their books unique 7 The cookie market includes all bakeries companies and independent bakers all selling similar products with different flavors 8 In fishing towns or villages the market for fish pulls its supply from the same waters and there are typically many fishermen selling the exact same fish 9 Parrott Ga is a very small town that has only one gas station 10 UPS the Post Office and FEDEx are the three dominant companies in the shipping industry

Biology
The Living WorldAll animals biotic factors breathe in oxygen abiotic factor All plants biotic factor absorb carbon dioxide abiotic factor and need water abiotic factor to survive TEXT ANSWER Create a list all of the biotic and abiotic factors in the grassland ecosystem in the picture below Grassland Ecosystem Practice AKE

Biology
The Living WorldTrue or False A nonsense mutation happens when a nitrogenous base is changed in the DNA but the amino acid encoded is not change in the protein

Biology
The Living World27 Which of the following areas of the body would you expect to be axenic in a healthy person A lleum B Nasopharynx C Trachea D Ureter E Urethra 28 The lysosome is involved in which step of phagocytosis A Adherence B Chemotaxis C Digestion D Ingestion 8

Biology
The Living World4 A particular antibiotic kills 90 of a population of infection causing bacteria in abo 2 days Assuming the person continues to take the antibiotic as prescribed what would you expect to happen over the next 2 days A 10 of the remaining bacteria will be killed B 90 of the remaining bacteria will be killed C All of the remaining bacteria will be killed D The immune system will take care of the rest E The remaining bacteria will all develop resistance 0

Biology
The Living WorldSea Lion Population Size in thousands a 100 000 b 125 000 325 300 275 250 225 200 175 150 125 135 000 100 III 75 50 20 Figure 1 Change in the population size of sea lions over time Error bars represent 2SEx Which of the following best estimates the population size of the sea lions in 2000 based on the data shown in Figure 1 1975 1980 1985 1990 1995 2000 2005 2010 2015 Year

Biology
The Living World22 Tetanus toxin works by A Directly stimulating muscle contraction B Preventing inhibitory nerve impulses C Preventing release of acetylcholine D Stimulating a large number of T cells E Targeting and killing muscle cells 23 What is the function of lysozyme A To destroy phagocytes B To digest peptidoglycan C To interfere with ribosome function D To opsonize microbes E To trigger vasodilation

Biology
The Living World13 Which of the following is not a characteristic of a typical exotoxin A It can be released by Gram positive or Gram negative bacteria B It can cause disease even when the pathogen cells aren t present C It is made of protein qua D It is released from a pathogen to attack the host E It will survive autoclaving and still be toxic

Biology
The Living World3 Chicken pox is caused by varicella zoster virus and it affects humans during their childhood However shingles is manifested in adult people Why a Chronic condition b Recurrence c Prolonged illness d Extended prodromal period e Long incubation time

Biology
The Living WorldIn 1918 the Spanish flu spread around the world killing an estimated 50 million people This is an example of a an disease A Endemic B Epidemic C Pandemic D Prevalent E Sporadic

Biology
The Living World15 Rb is considered a tumor suppressor gene product because it prevents progression through the cell cycle How is this inhibition relieved so the cell can divide

Biology
The Living WorldRead the following line and answer the question that follows I was a man once I m a beast now and they made me what I am Who speaks these lines and to whom Bishop Persome Convict Bishop Convict Persome

Biology
The Living WorldRead the following lines and answer the question given below Convict Ah thanks thanks Monseigneur I I Ah I m a fool a child to cry b somehow you have made me feel that that it is just as if something had come int me as if I were a man again not a wild beast The lines are spoken by the convict before he left the Bishop s house Why do you think the convict thanked the Bishop For giving him the candlesticks For restoring faith in God and humanity For prou

Biology
The Living World960 ENGAGE What happened when wolves were introduced to Coronation Island Coronation Island is a small island 116 km off the Alaskan coast A resident black tailed deer population had overgrazed the island and as a result very little forest understory remained and many common plant species were absent The forest was quite open and park like and not dense like a typical South Alaskan forest Researchers noted that the deer on the island were smaller than those in other populations and that several died each year from malnutrition In 1960 the Alaska Department of Fish and Game released two breeding pairs of timberwolves onto the island Their aim was to control the black tailed deer top right which had been overgrazing the land Initially wolves fed off the deer lower right bred successfully and deer numbers fell The island s vegetation began to return and by 1964 the vegetation was quite abundant However within a few years the deer population crashed The wolves ran out of food deer and began eating each other causing a drop in wolf numbers Within 8 years only one wolf remained on the island and the deer were once again abundant By 1983 wolves were absent and the deer numbers were high Coronation Island FF Two breeding pairs of wolves introduced Black tailed deer Gray well consuming deer Pre 1960 1960 1964 No wolves Abundant deer Wolves introduced Abundant deer 1968 1 wolf Abundant deer 13 wolves Few deer 1 Work in pairs to evaluate the introduction of wolves to Coronation Island What did it show Was it a success 2 If the experiment was carried out at a larger scale on a bigger island with more resources do you think the outcome would have been different What is your reasoning

Biology
The Living WorldDifferentiate between HIV 1 and HIV 2 Include their probable origins and any differences in disease presentation or development 2 pts

Biology
The Living WorldBiology Deduce and explain the effects of mutations in lacy that causes transcription to terminate in the middle of the gene

Biology
The Living World7 The results of endotoxin in the body can include A Drop in blood pressure B Fever C Internal blood clotting D A and B E All of the above

Biology
The Living World57 Which color of visible light has the shortest wavelength and highest energy 58 What is the primary difference between radio waves and microwaves 59 What is the primary difference between infrared radiation and ultraviolet radiation

Biology
The Living World25 What should you do if an emergency vehicle is approaching you from behind with sirens and flashing lights stop Pull over to the curb or edge of the road and Maintain


Biology
The Living WorldQuestion 23 of 25 23 You can identify aggressive drivers by Erratic and improper lane changes The number of passengers in their car Their tendency to drive slow


Biology
The Living WorldQuestion 21 of 25 21 BAC means Blood alcohol concentration Blood alcohol content Blood alcohol conservation



Biology
The Living Worldtion 15 OT 25 5 This road sign means LEFT TURN YIELD ON GREEN Yield before turning left at a green signal

Biology
The Living Worldnewer vehicles to prevent crashes Now if your mind wanders your car won t Lane keeping assistance helps save lives Automatic emergency braking and lane NHTSA


Biology
The Living World11 You are car A and the traffic in front of you is stopped You should A B Move up and stop between the railroad crossing gates in case they close Move up directly behind the red car B and wait for traffic to proceed Wait until you can completely cross over the


Biology
The Living Worldhighway with its lights flashing move over or slow down there CO MOMARYLAND DEPARTMENT OF TRANSPORTATION Flash your high beams so they know you are Maryland motorists must move over


Biology
The Living World7 How can you keep vehicle technologies operating at their peak Now if your mind wanders your car won t KOI 7



Biology
The Living World4 The maximum posted speed limit should be driven only During the night During the day

Biology
The Living WorldYou cannot make a U turn on a curve or a hill where your vehicle cannot seen at least away by the driver of another vehicle proceedi in either direction fel 700 feet 500 feet 900 feet 600 feet

Biology
The Living WorldIf we had only 2 different DNA RNA nucleotides e g A and T strings of how many nucleotides would be required to uniquely encode all 20 amino acids i e What is the minimum word length

Biology
The Living WorldImagine that you repeat Seymor Benzer s tRNA Selection experiment with modifications as follows 1 Synthesize mRNA containing A s and G s only poly AG in random order 2 Convert the amino acid Glutamic acid Glu on its tRNA to the amino acid Glutamine Gln as shown below 3 Mix your poly AG RNA your artificial tRNA and cell extract contains ribosomes amino acids all normal tRNAs and the energy source for translation Glu Gin CUC CUC Glutamic acid Glu is encoded by GAA and GAG while Glutamine Gln is encoded only by CAA and CAG Will Glutamic acid Glu be found in the resulting polypeptides this is a bit tricky so review the contents of the assay above Yes because ribosomes select the amino acid regardless of the anticodon sequence Yes because all of the normal tRNAs are present in the cell extract so Glutamic acid can also inserted when GAG or GAA codons appear in the mRNA Yes for both of the reasons listed above No because only Gin is present on the tRNA with the CUC anticodon

Biology
The Living WorldPick an activity outside of an organized sport that you enjoy Middle The title of the activity and some words pictures or art to go with it Upper Left Who taught you the activity and when did you first start Upper Right Equipment needed to participate safely and will help you be the best you can be to your ability Bottom Left People you share the activity with and how often you participate in the activity Bottom Right Any favorite skills or a skill you are good at Any professional athletes or teams you look up to Along Bottom or Around What would you change about the activity A piece of equipment you would design to help you succeed Examples and Templates Templates https drive google com file d 1 yiG1eeiE2Eg8xG qTf7UdmOUDG2Rxsl view usp sharing

Biology
The Living WorldIn a certain mutant strain of bacteria the enzyme Leucyl tRNA Synthetase mistakenly attaches cysteine to leucyl tRNA instead of leucine The result would be that Protein synthesis will stop at the first leucine codon because the incorrectly matched tRNAs will not be recognized by the ribosome O Proteins will have cysteine inserted in positions normally occupied by leucine O Proteins will have leucine inserted in positions normally occupied by cysteine Protein synthesis will be normal because the ribosome reads the mRNA and selects the tRNA based on the attached amino acid


Biology
The Living WorldWhat two animals would fit in this type A bee and flower B M C tick and human wolf and moose

Biology
The Living World22 Referring to the genetic code presented in Figure 15 10 give the amino acids specified by the following bacterial mRNA sequences a 5 AUGUUUAAAUUUAAAUUUUGA 3 b 5 AGGGAAAUCAGAUGUAUAUAUAUAUAUGA 3 c 5 UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA 3 d 5 GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUUUUGA 3