Molecular Basis of Inheritance Questions and Answers

Very often an organism's traits are caused by a combination of its genes and its environment. Think about the green color you saw in the genetically transformed bacteria: a. What two factors must be present in the bacteria's environment for you to see the green color? b. Explain why each of the two environmental factors listed above is needed to cause the genetically transformed bacteria to turn green.

With respect to DNA replication you should know the following Names of all the enzymes involved in DNA replication and their function What is origin of replication and what is the meaning of license What are Leading and lagging strands What are Okazaki fragments

Which of the following statements is TRUE? RNA polymerase Ill synthesizes tRNA Insertion mutations replaces a base pair for another AAUAAA is an Eukaryotic promoter sequence tRNA carrying the next amino acid enters the E site RNA polymerase I synthesizes mRNA

Use the space provided to answer the questions and draw a model to explain how the boys in the video (and anyone with DMD) acquired it and how this relates to their physical symptoms. 1. How does someone acquire (get) Duchenne Muscular Dystrophy? Is DMD inherited from a person's parents or do they get it from the environment? Explain.

An individual is found to have an inherited mutation in a gene associated with breast cancer. In which cells is this form of the gene located? Only in the cells of the breast and ovaries. All the cells of the individual. Only in those cells found in females. Only in cells of both breasts.

What is the relationship among genes, DNA, and chromosomes? Genes are composed of DNA and lie within chromosomes. Genes are found only in chromosomes and not DNA. Genes are found only in DNA and not chromosomes. Genes are separate entities from either DNA or chromosomes.

In the DNA sequence 5'-ACTG-3', the phosphodiester linkage between the cytosine and the thymine connects: O the 3' end of the thymine to the 5' end of the cytosine. O the 3' end of the cytosine to the 5' end of the thymine. O the 5' end of the thymine to the 1' end of the cytosine. O the 2' end of the thymine to the 3' end of cytosine. O the 5' end of the cytosine to the 2' end of the thymine.

For the numbered steps below, place them in the correct order from start to finish. 1) The ribosome binds to the mRNA and uses tRNAs to translate mRNA into the corresponding amino acid polypeptide sequence. 2) The spliceosome removes introns. 3) The primary structure of the polypeptide chain undergoes hierarchical folding to form the tertiary structure. 4) RNA polymerase binds to the promoter region of a gene and initiates transcription. O 4,2,1,3 O 2,4, 1,3 O 1,4,2,3 O 3, 4, 2, 1

A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe- ser-pro-phe-arg. a Postulate a base sequence in mRNA that would direct the synthesis of this hormone. Include an initiation (start) codon and a termination (stop) codon b. What is the nucleotide sequence of DNA that codes for this mRNA?

What repair system is used to fix DNA damage such as thymine dimers? nucleotide excision repair non-sister chromatid repair mutation repair mismatch repair broken strand repair

Match the following terms. DNA synthesis using complementary base pairing. Copying the DNA prior to cell division. gene expression Creating a complementary RNA molecule using one side of the DNA as a template. replication Making a protein using the instructions stored in the messenger RNA, according to The Genetic Code. transcription A two-step process that involves using the information coded in the DNA to provide instructions for the assembly of RNA, followed by using information coded in the RNA for the assembly of proteins. transcription

Sickle Cell Anemia (SCA) is a genetic anomaly that causes blood vessels to sickle when under oxygen stress. These sickled cells can get stuck in the capillaries of the body, cause pain, the loss of sight, the loss of limbs and even death. The protein hemoglobin B (HBB) is affected in this anomaly. Here is the normal DNA for a section of HBB GTG CAC CTC AGT CCA GAG GAG Mutated DNA: GTG CAC CTC AGT CCA GTG GAG a. What type of mutation caused the HBB gene to sickle? Please put an asterisk above the mutated DNA where the mutation occurred b. What are three symptoms of Sickle Cell Anemia? c. What did the mutation do to the shape of HBB?

Translate the following RNA sequences into an Amino Acid sequence. 1) CUU-CCU-GCG 2)UUA-CCC-GCC What do you notice about the 2 Amino Acid sequences? A. Nothing B. The 2 different RNA sequences code for the same Amino Acids. C. There is more than one way to get the same Amino Acid. D. Answers B and C are correct.

Given the DNA sequence below, transcribe and translate it into an Amino Acid sequence. TAC GTA TCG ACA Methionine-Histidine-Serine-Cysteine Histidine-Cysteine-Serine-Methionine Cysteine-Serine-Methionine-Histidine Serine-Methionine-Cysteine-Histidine

Environmental factors typically activate genes in a cell by causing the cell to - A produce identical daughter cells through mitosis B form haploid gamete cells through meiosis C fuse with another cell to increase the size of its genome D transcribe specific DNA segments to mRNA for translation

...radiation excites atoms to a higher energy state within molecules such as DNA that then leads to the formation of pyrimidine dimers. Infrared Ultraviolet Gamma Particle lonizing

35) The human genome project is dedicated to the sequencing of the human genetic code. Some people are opposed to sequencing the genomes of individuals, for privacy, among other reasons. However, there are two sides to this issue. What is one potential benefit of genome sequencing that can be weighed against possible negative effects? A) Knowledge of your genome will lead to higher insurance costs. B) Knowledge of your genome could be used to develop a vaccine for the common cold. QKnowledge of your genome could help you prepare for, or even prevent, some diseases. D) Knowledge of your genome could help you prepare for, or even prevent, almost all diseases

Which of the following is NOT a feature of DNA replication? each chromosome has one origin of replication replication bubbles spread in two directions a new strand is synthesized using an old one as a template complementary base pairing determines which nucleotides should be added to the new strand

The cars of Arnett, Bradley, Church, and Dawson are gray, red, silver, and yellow. • Bradley and Church had lunch yesterday with the owner of the silver car. • Dawson saw the owners of the red car and the gray car passing his house yesterday. • The owner of the yellow car thinks he got a better deal on his car than Arnett and Dawson got on theirs. Bradley's car is not a bright color. Find each person's car color. Arnett Bradley Church Dawson

c. One genetic change associated with the disorder results in a methionine-to-valine substitution at amino acid position 425 of the encoded polypeptide. Using your codon table predict a DNA point mutation that will result in a methionine-to-valine substitution.

Referring to the template DNA sequence below, if DNA polymerase III moves from left to right across the paper, what would be the sequence of the leading daughter strand synthesized? 5' ACGTCTGGAACTCGT 3' 3' TGCAGACCTTGAGCA 5' 5' ACGTCTGGAACTCGT 3¹ 5' ACGAGTTCCAGACGT 3' 5' TGCAGACCTTGAGCA 3' 5' TGCTCAAGGTCTGCA 3'

Imagine that a DNA sequence of A-C-G-T-A-C-G-T is altered to A-C-G-A-C-G-T. This could have happened as a result of a(an) mutation. Point Translocation Deletion Insertion

The two strands of the DNA molecule are antiparallel alternating palindromic identical parallel

DNA polymerase requires a template for the synthesis of DNA can add nucleotides in two different directions fills in gaps in DNA can work with both single-stranded and double-stranded DNA

When a repressor binds to the operator site on DNA, it blocks RNA polymerase and mRNA synthesis it links adjacent thymines and alters DNA folding it prevents the binding of the substrate to the operate site it links adjacent thymines and alters DNA folding

6. Before an activator can bind to DNA, it must react with the substrate it regulates the two strands of DNA must separate it must be released from the repressor part of the operon it must be cleaved into two subunits

A trait undergoing directional selection will increase in overall variation from one generation to the next. True False

1. DNA replicates in a ______ mode 2. In the DNA given below which is the coding strand and which is the template strand. What is the difference between the two?

Transcribe and translate the DNA given below. Given below is the coding strand. 5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 3'

Given below is the anticodon in a tRNA. What amino acid does this tRNA code for? 5' CAU 3'

1. Transcribe and translate the DNA given below. Given below is the coding strand. 5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 3 2. Given below is the anticodon in a tRNA. What amino acid does this tRNA code for? (1) 5' CAU 3' 3. In a cell a certain a specific gene needs to transcribed. The cell activates this gene by acetylating histone. How is this helpful in activating the gene?

22. Given below is a sequence 5' ATGGTAGGGG GTATTAAATC CAGTTATCAG AGGATCGGGA CCGAATAGGT 3' a. Is this an mRNA or DNA sequence. How can you tell? b. If the 8th G is replaced by C what kind of mutation is that lead to mutation c. If the 9th nucleotide is replaced by C what kind of mutation is that will lead to mutation d. If the 10th G is removed what kind of mutation is that mutation and it will and it and it will lead to e. If 40 to 45 nucleotides are added to the sequence after the 30th nucleotide what kind of mutation is that

An antibiotic that interferes with the structure or function of (the) O cell wall O DNA O RNA O cell membrane O protein would be most likely to have serious side effects.

Which of the following mutation is likely to be the most lethal form? back mutation missense mutation silent mutation nonsense mutation viruses

4a) In watermelon, fruit shape may be short or long, color may be striped or green. A homozygous long, green melon was crossed with a homozygous short, striped variety. The F1 individuals were all long, striped melons. Show the Punnet Square. Which traits are dominant? Which traits are recessive? 4b) Now cross two of the F₁ individuals from the previous problem. What are the expected phenotypic and genotypic ratios in the F2?

DNA fingerprinting is used to a. Amplify DNA b. Silence genes c. Identify pathogens d. genetically modify crops

A targeted and specific change in a gene is a. DNA fingerprinting b. Mutation c. Colony hybridization d. Site directed mutagenesis

Which of the following statements are true? Transcription occurs in the nucleolus and translation occurs in the nucleus. Transcription and translation both occur in the nucleus. Transcription and translation both occur in the cytoplasm Transcription occurs in the nucleus and translation occurs in the cytoplasm.

In what cellular location is ribosomal RNA (rRNA) produced? O Nucleolus O Endoplasmic reticulum O Nuclear pore Chloroplast

Translation of new proteins occurs in the nucleus. O True O False

During protein production, what is the name of the process in which RNA is used to make protein? Replication Transcription Translation Exocytosis

Which of the following can lead to a change in genetic information? Conjugation Mutations all of these are correct lonizing radiation Transformation

If you removed the promoter from a gene, what problem would that cause? A. RNA polymerase would transcribe the gene in the wrong direction. B. RNA polymerase wouldn't be able to add a 5' cap. C. RNA polymerase wouldn't know where to stop transcription. D. RNA polymerase wouldn't be able to initiate transcription of that gene. E. RNA polymerase wouldn't be able to splice out introns.

Which of the following parts of a gene is present in the primary transcript but NOT in the mRNA? A. exon B. start codon C. promotor D. intron E. UTR

A stop codon is A. UGA B. UGG C. AUG D. UUA

At the start of the citric acid cycle, acetyl CoA combines with ___ A. malate B. oxaloacetate C. citrate D. pyruvate

Enter the corresponding mRNA segment to the BRACA1 gene. Enter the nucleotide sequence using capitalized abbreviations. 5' ___3'

The complementary mRNA template for the following DNA strand is 3'-CCAGGCAAC-5' A. 3-GGUCCGUUG-5' B. 5'-GGTCCGTTG-3' C. 5'-UUGAAUGGU-3' D. 5'-GGUCCGUUG-3'