Biology Questions
The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.
![5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows](https://media.kunduz.com/media/sug-question-candidate/20231208013822435079-6098643.jpg?w=256)
Biology
The Living World5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows
![Can you write a takehome message about what you learned about career service](https://media.kunduz.com/media/sug-question-candidate/20231208003013482056-4426144.jpg?w=256)
Biology
Ecology - GeneralCan you write a takehome message about what you learned about career service
![Can you write a takehome message about what you learned about career service](https://media.kunduz.com/media/sug-question-candidate/20231208003005362170-4426144.jpg?w=256)
Biology
Biological ClassificationCan you write a takehome message about what you learned about career service
![Can you write a takehome message about career service](https://media.kunduz.com/media/sug-question-candidate/20231208002356900665-4426144.jpg?w=256)
![Can you write a takehome message about career service](https://media.kunduz.com/media/sug-question-candidate/20231208002350038467-4426144.jpg?w=256)
![Can you write a takehome message about career service](https://media.kunduz.com/media/sug-question-candidate/20231208002343058755-4426144.jpg?w=256)
![Which choice best describes data from the table that support the team s conclusion Choose 1 answer B Adenine and xanthine were detected in both of the meteorite samples and in the soil sample Isoguanine and hypoxanthine were detected in the Murchison meteorite sample 1 but not in sample 2 Isoguanine and purine were detected in both meteorite samples but not in the soil sample Hypoxanthine and purine were detected in both the Murchison meteorite sample 2 and in the soil sample](https://media.kunduz.com/media/sug-question-candidate/20231207232313169617-6346056.jpg?w=256)
Biology
Ecology - GeneralWhich choice best describes data from the table that support the team s conclusion Choose 1 answer B Adenine and xanthine were detected in both of the meteorite samples and in the soil sample Isoguanine and hypoxanthine were detected in the Murchison meteorite sample 1 but not in sample 2 Isoguanine and purine were detected in both meteorite samples but not in the soil sample Hypoxanthine and purine were detected in both the Murchison meteorite sample 2 and in the soil sample
![RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3](https://media.kunduz.com/media/sug-question-candidate/20231207193730738898-4555708.jpg?w=256)
Biology
Biological ClassificationRNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3
![Predict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response](https://media.kunduz.com/media/sug-question-candidate/20231207045548104502-4144409.jpg?w=256)
Biology
The Living WorldPredict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response
![Which of the following is true about pasteurization Mark all that apply It renders food sterile It kills pathogens It reduces the number of spoilage causing microbes HTST pasteurization uses 72 degrees Celsius for 60 minutes Question 6 T 0 5 pts](https://media.kunduz.com/media/sug-question-candidate/20231207015321212667-5971119.jpg?w=256)
Biology
EvolutionWhich of the following is true about pasteurization Mark all that apply It renders food sterile It kills pathogens It reduces the number of spoilage causing microbes HTST pasteurization uses 72 degrees Celsius for 60 minutes Question 6 T 0 5 pts
![Which antibiotic would the doctor NOT prescribe to a patient with an infection caused by the bacteria growing on this plate View Image Ciprofloxacin Rifampicin](https://media.kunduz.com/media/sug-question-candidate/20231207015415863477-5971119.jpg?w=256)
Biology
Ecology - GeneralWhich antibiotic would the doctor NOT prescribe to a patient with an infection caused by the bacteria growing on this plate View Image Ciprofloxacin Rifampicin
![D Antibacterial soaps used in the lab contain some form of O Alkylating agents O Phenolics O Peroxygens Question 7 0](https://media.kunduz.com/media/sug-question-candidate/20231207015345792497-5971119.jpg?w=256)
Biology
Human Health and DiseasesD Antibacterial soaps used in the lab contain some form of O Alkylating agents O Phenolics O Peroxygens Question 7 0
![What is the BSL for our Micro class answer A Select and what would it be for agents that cause hemorrhagic fever several bleeding organ failure and death answer B Select Select Biosafety Level 1](https://media.kunduz.com/media/sug-question-candidate/20231207014313312074-5971119.jpg?w=256)
Biology
Human Health and DiseasesWhat is the BSL for our Micro class answer A Select and what would it be for agents that cause hemorrhagic fever several bleeding organ failure and death answer B Select Select Biosafety Level 1
![Which process eliminates all vegetative cells endospores spores and viruses from culture liquid media in glass bottles O Disinfection O Antisepsis O Sterilization Sanitization Sanitization O Disinfection O Sterilization O Antisepsis](https://media.kunduz.com/media/sug-question-candidate/20231207014337074701-5971119.jpg?w=256)
Biology
Ecology - GeneralWhich process eliminates all vegetative cells endospores spores and viruses from culture liquid media in glass bottles O Disinfection O Antisepsis O Sterilization Sanitization Sanitization O Disinfection O Sterilization O Antisepsis
![True False Question 6 2 points E Listen The Supreme Court ruled in Kane v Garcia Espitia that detainees who are representing themselves in a criminal trial must have access to all legal materials available to convicted prisoners in state prisons True False Question 7 2 points Saved 4 Listen Saved A pardon granted under federal law totally discharges a person from all effects of the conviction resulting in the restoration of voting rights and other civil rights True False Question 8 2 points Listen All of the following are accurate statements about federal supervised release except A term of supervised release is imposed are the time of sentencing All supervised release violators are subject to mandatory periods of additional confinement if conditions of supervised release are violated Persons on supervised release have conditions that are monitored by probation officers](https://media.kunduz.com/media/sug-question-candidate/20231206130615018217-6338393.jpg?w=256)
Biology
Ecology - GeneralTrue False Question 6 2 points E Listen The Supreme Court ruled in Kane v Garcia Espitia that detainees who are representing themselves in a criminal trial must have access to all legal materials available to convicted prisoners in state prisons True False Question 7 2 points Saved 4 Listen Saved A pardon granted under federal law totally discharges a person from all effects of the conviction resulting in the restoration of voting rights and other civil rights True False Question 8 2 points Listen All of the following are accurate statements about federal supervised release except A term of supervised release is imposed are the time of sentencing All supervised release violators are subject to mandatory periods of additional confinement if conditions of supervised release are violated Persons on supervised release have conditions that are monitored by probation officers
![In the reaction catalyzed by aconitase the conversion of citrate to isocitrate is inhibited by fluoroacetate Fluoroacetate is used as a pesticide Why is this an effective pesticide O It inhibits glycolysis O It inhibits pyruvate oxidation O It inhibits the Krebs cycle It inhibits the electron transport chain O It inhibits ATP synthase QUESTION 36 Carbon dioxide and water can combine to form glucose water and oxygen What is required for that process to occur O Nothing this is a spontaneous reaction O Energy from the process of cellular respiration O Light energy from the sun O Mitochondria](https://media.kunduz.com/media/sug-question-candidate/20231206063015697589-4348260.jpg?w=256)
Biology
Cell Cycle and Cell DivisionIn the reaction catalyzed by aconitase the conversion of citrate to isocitrate is inhibited by fluoroacetate Fluoroacetate is used as a pesticide Why is this an effective pesticide O It inhibits glycolysis O It inhibits pyruvate oxidation O It inhibits the Krebs cycle It inhibits the electron transport chain O It inhibits ATP synthase QUESTION 36 Carbon dioxide and water can combine to form glucose water and oxygen What is required for that process to occur O Nothing this is a spontaneous reaction O Energy from the process of cellular respiration O Light energy from the sun O Mitochondria
![QUESTION 39 Plants that show a pattern of stomatal opening and closing that is the reverse of C3 plants are called O C4 Temperate O CAM O Calvin cycle QUESTION 40 If the gene encoding the enzyme rubisco is mutated such that it is non functional the process that would be affected is the ability to O make ATP O harvest photons Ofix carbon O make 02 make NADPH](https://media.kunduz.com/media/sug-question-candidate/20231206062948011208-4348260.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesQUESTION 39 Plants that show a pattern of stomatal opening and closing that is the reverse of C3 plants are called O C4 Temperate O CAM O Calvin cycle QUESTION 40 If the gene encoding the enzyme rubisco is mutated such that it is non functional the process that would be affected is the ability to O make ATP O harvest photons Ofix carbon O make 02 make NADPH
![If you tagged organic carbon inside a chloroplast with a fluorescent label the location most likely to have a high concentration of labeled carbon would be in the O Stroma O Thylakoid membrane O Between the outer and inner membranes O Inside the thylakoid QUESTION 38 Clusters of chlorophyll and accessory pigments are called O the Golgi apparatus O chloroplasts O photosystems O photosynthetic membranes](https://media.kunduz.com/media/sug-question-candidate/20231206062959911702-4348260.jpg?w=256)
Biology
Plant Physiology - GeneralIf you tagged organic carbon inside a chloroplast with a fluorescent label the location most likely to have a high concentration of labeled carbon would be in the O Stroma O Thylakoid membrane O Between the outer and inner membranes O Inside the thylakoid QUESTION 38 Clusters of chlorophyll and accessory pigments are called O the Golgi apparatus O chloroplasts O photosystems O photosynthetic membranes
![QUESTION 33 What stage of cellular respiration can occur in human cells with or without oxygen present O The Krebs cycle O Glycolysis O The electron transport chain O Pyruvate oxidation QUESTION 34 What is common to all of the oxidation reactions in the Krebs cycle O They all lead to the generation of NADH O They are all decarboxylation reactions O They are all characterized by a loss of electrons from an organic molecule coupled to the reduction of an electron acceptor They all lead to substrate level phosphorylation of ADP to generate ATP](https://media.kunduz.com/media/sug-question-candidate/20231206063027810152-4348260.jpg?w=256)
Biology
Anatomy of Flowering PlantsQUESTION 33 What stage of cellular respiration can occur in human cells with or without oxygen present O The Krebs cycle O Glycolysis O The electron transport chain O Pyruvate oxidation QUESTION 34 What is common to all of the oxidation reactions in the Krebs cycle O They all lead to the generation of NADH O They are all decarboxylation reactions O They are all characterized by a loss of electrons from an organic molecule coupled to the reduction of an electron acceptor They all lead to substrate level phosphorylation of ADP to generate ATP
![Organisms that can manufacture their own chemical energy are called O autotrophs O heterotrophs O oligotrophs O chemotrophs QUESTION 32 In animals that take in oxygen from their environment glucose is broken down into carbon dioxide and water in a process called O anaerobic respiration O organic compound respiration O glucose respiration aerobic respiration](https://media.kunduz.com/media/sug-question-candidate/20231206063040107721-4348260.jpg?w=256)
Biology
Ecology - Environmental IssuesOrganisms that can manufacture their own chemical energy are called O autotrophs O heterotrophs O oligotrophs O chemotrophs QUESTION 32 In animals that take in oxygen from their environment glucose is broken down into carbon dioxide and water in a process called O anaerobic respiration O organic compound respiration O glucose respiration aerobic respiration
![Mendel used the garden Olily carrot onion pea plant for his studies on inheritance QUESTION 48 In modern terminology Mendel s heredity factors are called O DNA O chromosomes O genes ORNA](https://media.kunduz.com/media/sug-question-candidate/20231206062849487690-4348260.jpg?w=256)
Biology
Molecular Basis of InheritanceMendel used the garden Olily carrot onion pea plant for his studies on inheritance QUESTION 48 In modern terminology Mendel s heredity factors are called O DNA O chromosomes O genes ORNA
![The division of a O cell wall develops cracks around the equator of the cell O chromosomes are pulled toward the ends of the cell O actin and microtubules constrict the cytoplasm O new membrane and cell wall materials begin to grow and form a septum QUESTION 42 These structures are held together by cohesin O Nucleosomes O Sister chromatids O Homologous chromosomes O Solenoids](https://media.kunduz.com/media/sug-question-candidate/20231206062935390316-4348260.jpg?w=256)
Biology
Biotechnology & its ApplicationsThe division of a O cell wall develops cracks around the equator of the cell O chromosomes are pulled toward the ends of the cell O actin and microtubules constrict the cytoplasm O new membrane and cell wall materials begin to grow and form a septum QUESTION 42 These structures are held together by cohesin O Nucleosomes O Sister chromatids O Homologous chromosomes O Solenoids
![Homologous chromosomes pair along their length during prophase I of meiosis While two homologues are paired genetic exchange may occur between them in a process called O syngamy O synapsis O independent assortment O crossing over QUESTION 46 The fusion of a male gamete with a female gamete is called O syngamy O meiosis Omitosis O recombination O synapsis](https://media.kunduz.com/media/sug-question-candidate/20231206062907077474-4348260.jpg?w=256)
Biology
Human ReproductionHomologous chromosomes pair along their length during prophase I of meiosis While two homologues are paired genetic exchange may occur between them in a process called O syngamy O synapsis O independent assortment O crossing over QUESTION 46 The fusion of a male gamete with a female gamete is called O syngamy O meiosis Omitosis O recombination O synapsis
![Based on hierarchical levels of biological organization which of these choices represents the broadest level O Endocrine system O3 toed sloths O School of piranhas O Amazon Basin O Jaguars giant anteaters macaws capybaras QUESTION 2 Experiments are carried out to test a hypothesis by changing one variable at a time and including an unchanged variable terrted a n O experimental variable O altered variable O control](https://media.kunduz.com/media/sug-question-candidate/20231206062722335035-4348260.jpg?w=256)
Biology
Biotechnology & its ApplicationsBased on hierarchical levels of biological organization which of these choices represents the broadest level O Endocrine system O3 toed sloths O School of piranhas O Amazon Basin O Jaguars giant anteaters macaws capybaras QUESTION 2 Experiments are carried out to test a hypothesis by changing one variable at a time and including an unchanged variable terrted a n O experimental variable O altered variable O control
![QUESTION 49 Traits that are controlled by genes located on the X chromosome are said to be O autosomal O gametal O sex linked Opleiotropic QUESTION 50 The lagging strand is replicated with a series of Okazaki fragments and that is why its synthesis is considered to be O discontinuous O continuous O bidirectional O antiparallel Osemiconservative](https://media.kunduz.com/media/sug-question-candidate/20231206062836970262-4348260.jpg?w=256)
Biology
Molecular Basis of InheritanceQUESTION 49 Traits that are controlled by genes located on the X chromosome are said to be O autosomal O gametal O sex linked Opleiotropic QUESTION 50 The lagging strand is replicated with a series of Okazaki fragments and that is why its synthesis is considered to be O discontinuous O continuous O bidirectional O antiparallel Osemiconservative
![QUESTION 9 Sugars dissolve well in water because of water s O polarity O ionic bonds O hydrophobic exclusion O cohesiveness QUESTION 10 Atomic nuclei contain protons and O moles O neutrons O isomers inns](https://media.kunduz.com/media/sug-question-candidate/20231206062822073231-4348260.jpg?w=256)
Biology
Human Physiology - Breathing & Exchange of GasesQUESTION 9 Sugars dissolve well in water because of water s O polarity O ionic bonds O hydrophobic exclusion O cohesiveness QUESTION 10 Atomic nuclei contain protons and O moles O neutrons O isomers inns
![A cell biologist produces a karyotype of mouse somatic cells arrested in mitosis She sees 40 chromosomes which is completely normal for mice Based on this information what is the haploid number of chromosomes for mice OO 10 20 40 80 O It cannot be determined from the information provided QUESTION 44 is a process of nuclear division which reduces the number of chromosomes per cell from 2 sets to 1 set O Mitosis O Meiosis O Binary fission O Syngamy](https://media.kunduz.com/media/sug-question-candidate/20231206062920549562-4348260.jpg?w=256)
Biology
Ecology - GeneralA cell biologist produces a karyotype of mouse somatic cells arrested in mitosis She sees 40 chromosomes which is completely normal for mice Based on this information what is the haploid number of chromosomes for mice OO 10 20 40 80 O It cannot be determined from the information provided QUESTION 44 is a process of nuclear division which reduces the number of chromosomes per cell from 2 sets to 1 set O Mitosis O Meiosis O Binary fission O Syngamy
![QUESTION 7 The number of protons in a given atom is equal to its O neutron number O mass O atomic number O molecular number QUESTION 8 Atoms containing a specific number of protons are called O molecules O minerals O metals elements](https://media.kunduz.com/media/sug-question-candidate/20231206062806910414-4348260.jpg?w=256)
Biology
BiomoleculesQUESTION 7 The number of protons in a given atom is equal to its O neutron number O mass O atomic number O molecular number QUESTION 8 Atoms containing a specific number of protons are called O molecules O minerals O metals elements
![QUESTION 5 A suggested explanation that might be true and is subject to testing by further observations is a n O hypothesis O experiment O scientific principle O generality O theory QUESTION 6 All atoms possess the ability to do work The term that is defined as the ability to do work is O matter O energy molecules 4](https://media.kunduz.com/media/sug-question-candidate/20231206062751999568-4348260.jpg?w=256)
Biology
BiomoleculesQUESTION 5 A suggested explanation that might be true and is subject to testing by further observations is a n O hypothesis O experiment O scientific principle O generality O theory QUESTION 6 All atoms possess the ability to do work The term that is defined as the ability to do work is O matter O energy molecules 4
![QUESTION 3 After Darwin concluded his voyage on the Beagle he proposed that the process of natural selection was a mechanism for O overpopulation of finches on the Galapagos Islands O speciation O artificial selection O sexual selection O evolution QUESTION 4 What common life characteristic would cells from a daisy an apple and a dog all have O DNA O tissues O organs O viruses](https://media.kunduz.com/media/sug-question-candidate/20231206062738306680-4348260.jpg?w=256)
Biology
BiomoleculesQUESTION 3 After Darwin concluded his voyage on the Beagle he proposed that the process of natural selection was a mechanism for O overpopulation of finches on the Galapagos Islands O speciation O artificial selection O sexual selection O evolution QUESTION 4 What common life characteristic would cells from a daisy an apple and a dog all have O DNA O tissues O organs O viruses
![DNA Rep Directions Drag the cards below to fill in the blanks in the paragraph about DNA replication lagging strand helicase There are many strand while I The 1 an RNA primer that lets i DNA primase 11 n 1 Topoisomerase Okazaki DNA fragments polymerase involved in DNA replication enzymes breaks the hydrogen bonds between bases I is made continuously while the I These fragments are glued together by I unwinds the DNA know where to begin adding new nucleotides ligase leading strand lays down is made in fragments called](https://media.kunduz.com/media/sug-question-candidate/20231206042554009825-6313787.jpg?w=256)
Biology
Principles of Inheritance & Variation (Genetics)DNA Rep Directions Drag the cards below to fill in the blanks in the paragraph about DNA replication lagging strand helicase There are many strand while I The 1 an RNA primer that lets i DNA primase 11 n 1 Topoisomerase Okazaki DNA fragments polymerase involved in DNA replication enzymes breaks the hydrogen bonds between bases I is made continuously while the I These fragments are glued together by I unwinds the DNA know where to begin adding new nucleotides ligase leading strand lays down is made in fragments called
![DNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5](https://media.kunduz.com/media/sug-question-candidate/20231205222809684968-4555708.jpg?w=256)
Biology
The Living WorldDNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5
![4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3](https://media.kunduz.com/media/sug-question-candidate/20231206004828443977-4555708.jpg?w=256)
Biology
Biotechnology & its Applications4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3
![A new disease wiped out the majority of a population The only individuals that survived were homozygous for a recessive allele that encodes for a form of an enzyme that is unaffected by the disease toxin The converse is true for the dominant allele that encodes for a form of the enzyme that is affected by the toxin This is an example of genetic drift natural selection the founder effect gene flow](https://media.kunduz.com/media/sug-question-candidate/20231205234704953191-5904656.jpg?w=256)
Biology
BiomoleculesA new disease wiped out the majority of a population The only individuals that survived were homozygous for a recessive allele that encodes for a form of an enzyme that is unaffected by the disease toxin The converse is true for the dominant allele that encodes for a form of the enzyme that is affected by the toxin This is an example of genetic drift natural selection the founder effect gene flow
![A bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population](https://media.kunduz.com/media/sug-question-candidate/20231205234647694042-5904656.jpg?w=256)
Biology
The Living WorldA bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population
![Which of the following is an example of the founder effect A tornado destroys all but 15 individuals in a toad population A group of 15 male and female birds from one species are stranded on an island Only ampicillin resistant bacteria survive in an ampicillin rich medium A group composed of 12 male birds from one species is released 5 miles from their home range](https://media.kunduz.com/media/sug-question-candidate/20231205234656332234-5904656.jpg?w=256)
Biology
Ecology - GeneralWhich of the following is an example of the founder effect A tornado destroys all but 15 individuals in a toad population A group of 15 male and female birds from one species are stranded on an island Only ampicillin resistant bacteria survive in an ampicillin rich medium A group composed of 12 male birds from one species is released 5 miles from their home range
![A large population of laboratory animals has been allowed to breed randomly for a number of generations After several generations 25 of the animals display a recessive trait aa the same percentage as at the beginning of the breeding program The rest of the animals show the dominant phenotype with heterozygotes indistinguishable from the homozygous dominants What proportion of the population is probably heterozygous Aa for this trait 0 75 0 05 0 50 0 25](https://media.kunduz.com/media/sug-question-candidate/20231205234617073555-5904656.jpg?w=256)
Biology
BiomoleculesA large population of laboratory animals has been allowed to breed randomly for a number of generations After several generations 25 of the animals display a recessive trait aa the same percentage as at the beginning of the breeding program The rest of the animals show the dominant phenotype with heterozygotes indistinguishable from the homozygous dominants What proportion of the population is probably heterozygous Aa for this trait 0 75 0 05 0 50 0 25
![You are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an autosomal trait that shows a recessive expression pattern What is the frequency of the deleterious harmful allele in the population 2 20 80 4](https://media.kunduz.com/media/sug-question-candidate/20231205234557532139-5904656.jpg?w=256)
Biology
The Living WorldYou are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an autosomal trait that shows a recessive expression pattern What is the frequency of the deleterious harmful allele in the population 2 20 80 4
![In the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways the population is diploid the population is doubling in number](https://media.kunduz.com/media/sug-question-candidate/20231205234549195748-5904656.jpg?w=256)
Biology
The Living WorldIn the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways the population is diploid the population is doubling in number
![Genetic variation is created by the direct action of natural selection arises in response to changes in the environment tends to be reduced when diploid organisms produce gametes must be present in a population before natural selection can act upon the population](https://media.kunduz.com/media/sug-question-candidate/20231205234431591332-5904656.jpg?w=256)
Biology
Biological ClassificationGenetic variation is created by the direct action of natural selection arises in response to changes in the environment tends to be reduced when diploid organisms produce gametes must be present in a population before natural selection can act upon the population
![12 Prepare 200 mL of 20 Sodium Dodecyl Sulfate SDS 13 Prepare 500 mL of 70 Ethanol 14 Prepare 500 mL of Plant DNA extraction Buffer 200mM Tris buffer 250 mM NaCl 25 mM EDTA and 0 5 SDS from stock solution that you make 1M Tris 0 5 M EDTA 5M NaCl and 20 SDS](https://media.kunduz.com/media/sug-question-candidate/20231205222125530522-6227938.jpg?w=256)
Biology
Ecology - General12 Prepare 200 mL of 20 Sodium Dodecyl Sulfate SDS 13 Prepare 500 mL of 70 Ethanol 14 Prepare 500 mL of Plant DNA extraction Buffer 200mM Tris buffer 250 mM NaCl 25 mM EDTA and 0 5 SDS from stock solution that you make 1M Tris 0 5 M EDTA 5M NaCl and 20 SDS
![A heterotroph is an organism that obtains it energy from consuming another organisms or dead organisms O False QUESTION 3 Which of the following is undergoing active cell respiration to provide ATP for the living organism O Inorganic soil O Geminating com seeds O Dry com seed QUESTION 4 Most plants only contain one pigment associated with photosynthesis that being cholorphyll](https://media.kunduz.com/media/sug-question-candidate/20231205215159753914-4348260.jpg?w=256)
Biology
Ecology - EcosystemsA heterotroph is an organism that obtains it energy from consuming another organisms or dead organisms O False QUESTION 3 Which of the following is undergoing active cell respiration to provide ATP for the living organism O Inorganic soil O Geminating com seeds O Dry com seed QUESTION 4 Most plants only contain one pigment associated with photosynthesis that being cholorphyll
![QUESTION 5 Place the steps of mitosis in chronological order Metaphase Prophase Telophase Anaphase QUESTION 6 Match the stage of mitosis with the correct description Metaphase Prophase Anaphase Telophase A Condensed chromosomes Nuclear envelop disappears B Chromosomes are pulled to opposite sides of the cell C Nuclear envelop appears around new nucleus D Chromosomes line up at the midpoint of the cell](https://media.kunduz.com/media/sug-question-candidate/20231205215143426999-4348260.jpg?w=256)
Biology
Ecology - GeneralQUESTION 5 Place the steps of mitosis in chronological order Metaphase Prophase Telophase Anaphase QUESTION 6 Match the stage of mitosis with the correct description Metaphase Prophase Anaphase Telophase A Condensed chromosomes Nuclear envelop disappears B Chromosomes are pulled to opposite sides of the cell C Nuclear envelop appears around new nucleus D Chromosomes line up at the midpoint of the cell
![There are no differences between the telophase cytokinesis in animal and plant cells True O False QUESTION 8 The plant pigment that provides yellow orange colors in plants is O Chlorophyll A O Carotene O Chlorophyll B O Melanin QUESTION 9 Most of the carbon that is incorporated into plants to give them mass and grow larger comes from O Carbon in the soil O Water O The sun](https://media.kunduz.com/media/sug-question-candidate/20231205215126017313-4348260.jpg?w=256)
Biology
Ecology - GeneralThere are no differences between the telophase cytokinesis in animal and plant cells True O False QUESTION 8 The plant pigment that provides yellow orange colors in plants is O Chlorophyll A O Carotene O Chlorophyll B O Melanin QUESTION 9 Most of the carbon that is incorporated into plants to give them mass and grow larger comes from O Carbon in the soil O Water O The sun
![If a solid line represents a covalent bond and a dotted line represents intermolecular attraction which of the choices shows a hydrogen bond H N H O H H H H OH CH3](https://media.kunduz.com/media/sug-question-candidate/20231205215230194098-4348260.jpg?w=256)
Biology
BiomoleculesIf a solid line represents a covalent bond and a dotted line represents intermolecular attraction which of the choices shows a hydrogen bond H N H O H H H H OH CH3
![The energy that supplies all living systems on earth ultimately comes from what QUESTION 11 The alcohol during the DNA extraction is used to separate the DNA from all of the other components of the cell O True False QUESTION 12 In a molecule of chlorophyll O Gold O Lithium Iron is the element in the middle of the molecule](https://media.kunduz.com/media/sug-question-candidate/20231205215037790563-4348260.jpg?w=256)
Biology
Ecology - GeneralThe energy that supplies all living systems on earth ultimately comes from what QUESTION 11 The alcohol during the DNA extraction is used to separate the DNA from all of the other components of the cell O True False QUESTION 12 In a molecule of chlorophyll O Gold O Lithium Iron is the element in the middle of the molecule
![QUESTION 3 The chemical bond connecting one nucleotide with the next along one strand of a DNA molecule is called a glycosidic bond O hydrogen bond O phosphate bond O phosphodiester bond O peptide bond QUESTION 4 Chargaff s rules for the pairing of nitrogen bases is OA C and G T O A T and G C 04 6 and C T](https://media.kunduz.com/media/sug-question-candidate/20231205193149096037-4348260.jpg?w=256)
Biology
Cell: The Unit of LifeQUESTION 3 The chemical bond connecting one nucleotide with the next along one strand of a DNA molecule is called a glycosidic bond O hydrogen bond O phosphate bond O phosphodiester bond O peptide bond QUESTION 4 Chargaff s rules for the pairing of nitrogen bases is OA C and G T O A T and G C 04 6 and C T
![As the two strands of DNA are unraveled which enzyme relieves the strain on the two strands O DNA polymerase O DNA ligase O DNA gyrase DNA endonuclease ODNA exonuclease QUESTION 2 Which is not a component of nucleic acids O organic nitrogenous base O pentose sugar Ophosphate sulfur](https://media.kunduz.com/media/sug-question-candidate/20231205193137032400-4348260.jpg?w=256)
Biology
BiomoleculesAs the two strands of DNA are unraveled which enzyme relieves the strain on the two strands O DNA polymerase O DNA ligase O DNA gyrase DNA endonuclease ODNA exonuclease QUESTION 2 Which is not a component of nucleic acids O organic nitrogenous base O pentose sugar Ophosphate sulfur
![If 16 of the nucleotides in one strand of a DNA molecule contain the base G what percent of the nucleotides on the complementary strand will also contain the base G O 16 O 8 O 34 32 O Impossible to determine from the information given QUESTION 24 Genetic analysis indicates that an unknown organism contains a gene that codes for a defective form of telomerase Based on this information alone you can conclude that this organism O is prokaryotic Ois eukaryotic O has unusually long telomeres O has an increased risk of developing cancer](https://media.kunduz.com/media/sug-question-candidate/20231205193434064004-4348260.jpg?w=256)
Biology
Cell: The Unit of LifeIf 16 of the nucleotides in one strand of a DNA molecule contain the base G what percent of the nucleotides on the complementary strand will also contain the base G O 16 O 8 O 34 32 O Impossible to determine from the information given QUESTION 24 Genetic analysis indicates that an unknown organism contains a gene that codes for a defective form of telomerase Based on this information alone you can conclude that this organism O is prokaryotic Ois eukaryotic O has unusually long telomeres O has an increased risk of developing cancer
![In eukaryotes translation takes place O on the plasma membrane O inside the nucleus Oon ribosomes O on the nuclear membrane on spliceosomes QUESTION 36 Ribosomes are complex aggregates of ORNA and DNA O RNA and proteins ORNA and sugars O DNA and proteins O nucleosomes and RNA](https://media.kunduz.com/media/sug-question-candidate/20231205193554673762-4348260.jpg?w=256)
Biology
Biotechnology & its ApplicationsIn eukaryotes translation takes place O on the plasma membrane O inside the nucleus Oon ribosomes O on the nuclear membrane on spliceosomes QUESTION 36 Ribosomes are complex aggregates of ORNA and DNA O RNA and proteins ORNA and sugars O DNA and proteins O nucleosomes and RNA