Biology Questions
The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.

Biology
EvolutionWhich of the following is true about pasteurization Mark all that apply It renders food sterile It kills pathogens It reduces the number of spoilage causing microbes HTST pasteurization uses 72 degrees Celsius for 60 minutes Question 6 T 0 5 pts

Biology
Ecology - GeneralWhich antibiotic would the doctor NOT prescribe to a patient with an infection caused by the bacteria growing on this plate View Image Ciprofloxacin Rifampicin

Biology
Human Health and DiseasesD Antibacterial soaps used in the lab contain some form of O Alkylating agents O Phenolics O Peroxygens Question 7 0

Biology
Human Health and DiseasesWhat is the BSL for our Micro class answer A Select and what would it be for agents that cause hemorrhagic fever several bleeding organ failure and death answer B Select Select Biosafety Level 1

Biology
Ecology - GeneralWhich process eliminates all vegetative cells endospores spores and viruses from culture liquid media in glass bottles O Disinfection O Antisepsis O Sterilization Sanitization Sanitization O Disinfection O Sterilization O Antisepsis

Biology
Ecology - GeneralTrue False Question 6 2 points E Listen The Supreme Court ruled in Kane v Garcia Espitia that detainees who are representing themselves in a criminal trial must have access to all legal materials available to convicted prisoners in state prisons True False Question 7 2 points Saved 4 Listen Saved A pardon granted under federal law totally discharges a person from all effects of the conviction resulting in the restoration of voting rights and other civil rights True False Question 8 2 points Listen All of the following are accurate statements about federal supervised release except A term of supervised release is imposed are the time of sentencing All supervised release violators are subject to mandatory periods of additional confinement if conditions of supervised release are violated Persons on supervised release have conditions that are monitored by probation officers

Biology
Cell Cycle and Cell DivisionIn the reaction catalyzed by aconitase the conversion of citrate to isocitrate is inhibited by fluoroacetate Fluoroacetate is used as a pesticide Why is this an effective pesticide O It inhibits glycolysis O It inhibits pyruvate oxidation O It inhibits the Krebs cycle It inhibits the electron transport chain O It inhibits ATP synthase QUESTION 36 Carbon dioxide and water can combine to form glucose water and oxygen What is required for that process to occur O Nothing this is a spontaneous reaction O Energy from the process of cellular respiration O Light energy from the sun O Mitochondria

Biology
Biotechnology: Principles and ProcessesQUESTION 39 Plants that show a pattern of stomatal opening and closing that is the reverse of C3 plants are called O C4 Temperate O CAM O Calvin cycle QUESTION 40 If the gene encoding the enzyme rubisco is mutated such that it is non functional the process that would be affected is the ability to O make ATP O harvest photons Ofix carbon O make 02 make NADPH

Biology
Plant Physiology - GeneralIf you tagged organic carbon inside a chloroplast with a fluorescent label the location most likely to have a high concentration of labeled carbon would be in the O Stroma O Thylakoid membrane O Between the outer and inner membranes O Inside the thylakoid QUESTION 38 Clusters of chlorophyll and accessory pigments are called O the Golgi apparatus O chloroplasts O photosystems O photosynthetic membranes

Biology
Anatomy of Flowering PlantsQUESTION 33 What stage of cellular respiration can occur in human cells with or without oxygen present O The Krebs cycle O Glycolysis O The electron transport chain O Pyruvate oxidation QUESTION 34 What is common to all of the oxidation reactions in the Krebs cycle O They all lead to the generation of NADH O They are all decarboxylation reactions O They are all characterized by a loss of electrons from an organic molecule coupled to the reduction of an electron acceptor They all lead to substrate level phosphorylation of ADP to generate ATP

Biology
Ecology - Environmental IssuesOrganisms that can manufacture their own chemical energy are called O autotrophs O heterotrophs O oligotrophs O chemotrophs QUESTION 32 In animals that take in oxygen from their environment glucose is broken down into carbon dioxide and water in a process called O anaerobic respiration O organic compound respiration O glucose respiration aerobic respiration

Biology
Molecular Basis of InheritanceMendel used the garden Olily carrot onion pea plant for his studies on inheritance QUESTION 48 In modern terminology Mendel s heredity factors are called O DNA O chromosomes O genes ORNA

Biology
Biotechnology & its ApplicationsThe division of a O cell wall develops cracks around the equator of the cell O chromosomes are pulled toward the ends of the cell O actin and microtubules constrict the cytoplasm O new membrane and cell wall materials begin to grow and form a septum QUESTION 42 These structures are held together by cohesin O Nucleosomes O Sister chromatids O Homologous chromosomes O Solenoids

Biology
Human ReproductionHomologous chromosomes pair along their length during prophase I of meiosis While two homologues are paired genetic exchange may occur between them in a process called O syngamy O synapsis O independent assortment O crossing over QUESTION 46 The fusion of a male gamete with a female gamete is called O syngamy O meiosis Omitosis O recombination O synapsis

Biology
Biotechnology & its ApplicationsBased on hierarchical levels of biological organization which of these choices represents the broadest level O Endocrine system O3 toed sloths O School of piranhas O Amazon Basin O Jaguars giant anteaters macaws capybaras QUESTION 2 Experiments are carried out to test a hypothesis by changing one variable at a time and including an unchanged variable terrted a n O experimental variable O altered variable O control

Biology
Molecular Basis of InheritanceQUESTION 49 Traits that are controlled by genes located on the X chromosome are said to be O autosomal O gametal O sex linked Opleiotropic QUESTION 50 The lagging strand is replicated with a series of Okazaki fragments and that is why its synthesis is considered to be O discontinuous O continuous O bidirectional O antiparallel Osemiconservative

Biology
Human Physiology - Breathing & Exchange of GasesQUESTION 9 Sugars dissolve well in water because of water s O polarity O ionic bonds O hydrophobic exclusion O cohesiveness QUESTION 10 Atomic nuclei contain protons and O moles O neutrons O isomers inns

Biology
Ecology - GeneralA cell biologist produces a karyotype of mouse somatic cells arrested in mitosis She sees 40 chromosomes which is completely normal for mice Based on this information what is the haploid number of chromosomes for mice OO 10 20 40 80 O It cannot be determined from the information provided QUESTION 44 is a process of nuclear division which reduces the number of chromosomes per cell from 2 sets to 1 set O Mitosis O Meiosis O Binary fission O Syngamy

Biology
BiomoleculesQUESTION 7 The number of protons in a given atom is equal to its O neutron number O mass O atomic number O molecular number QUESTION 8 Atoms containing a specific number of protons are called O molecules O minerals O metals elements

Biology
BiomoleculesQUESTION 5 A suggested explanation that might be true and is subject to testing by further observations is a n O hypothesis O experiment O scientific principle O generality O theory QUESTION 6 All atoms possess the ability to do work The term that is defined as the ability to do work is O matter O energy molecules 4

Biology
BiomoleculesQUESTION 3 After Darwin concluded his voyage on the Beagle he proposed that the process of natural selection was a mechanism for O overpopulation of finches on the Galapagos Islands O speciation O artificial selection O sexual selection O evolution QUESTION 4 What common life characteristic would cells from a daisy an apple and a dog all have O DNA O tissues O organs O viruses

Biology
Principles of Inheritance & Variation (Genetics)DNA Rep Directions Drag the cards below to fill in the blanks in the paragraph about DNA replication lagging strand helicase There are many strand while I The 1 an RNA primer that lets i DNA primase 11 n 1 Topoisomerase Okazaki DNA fragments polymerase involved in DNA replication enzymes breaks the hydrogen bonds between bases I is made continuously while the I These fragments are glued together by I unwinds the DNA know where to begin adding new nucleotides ligase leading strand lays down is made in fragments called

Biology
The Living WorldDNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5

Biology
Biotechnology & its Applications4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3

Biology
BiomoleculesA new disease wiped out the majority of a population The only individuals that survived were homozygous for a recessive allele that encodes for a form of an enzyme that is unaffected by the disease toxin The converse is true for the dominant allele that encodes for a form of the enzyme that is affected by the toxin This is an example of genetic drift natural selection the founder effect gene flow

Biology
The Living WorldA bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population

Biology
Ecology - GeneralWhich of the following is an example of the founder effect A tornado destroys all but 15 individuals in a toad population A group of 15 male and female birds from one species are stranded on an island Only ampicillin resistant bacteria survive in an ampicillin rich medium A group composed of 12 male birds from one species is released 5 miles from their home range

Biology
BiomoleculesA large population of laboratory animals has been allowed to breed randomly for a number of generations After several generations 25 of the animals display a recessive trait aa the same percentage as at the beginning of the breeding program The rest of the animals show the dominant phenotype with heterozygotes indistinguishable from the homozygous dominants What proportion of the population is probably heterozygous Aa for this trait 0 75 0 05 0 50 0 25

Biology
The Living WorldYou are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an autosomal trait that shows a recessive expression pattern What is the frequency of the deleterious harmful allele in the population 2 20 80 4

Biology
The Living WorldIn the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways the population is diploid the population is doubling in number

Biology
Biological ClassificationGenetic variation is created by the direct action of natural selection arises in response to changes in the environment tends to be reduced when diploid organisms produce gametes must be present in a population before natural selection can act upon the population

Biology
Ecology - General12 Prepare 200 mL of 20 Sodium Dodecyl Sulfate SDS 13 Prepare 500 mL of 70 Ethanol 14 Prepare 500 mL of Plant DNA extraction Buffer 200mM Tris buffer 250 mM NaCl 25 mM EDTA and 0 5 SDS from stock solution that you make 1M Tris 0 5 M EDTA 5M NaCl and 20 SDS

Biology
Ecology - EcosystemsA heterotroph is an organism that obtains it energy from consuming another organisms or dead organisms O False QUESTION 3 Which of the following is undergoing active cell respiration to provide ATP for the living organism O Inorganic soil O Geminating com seeds O Dry com seed QUESTION 4 Most plants only contain one pigment associated with photosynthesis that being cholorphyll

Biology
Ecology - GeneralQUESTION 5 Place the steps of mitosis in chronological order Metaphase Prophase Telophase Anaphase QUESTION 6 Match the stage of mitosis with the correct description Metaphase Prophase Anaphase Telophase A Condensed chromosomes Nuclear envelop disappears B Chromosomes are pulled to opposite sides of the cell C Nuclear envelop appears around new nucleus D Chromosomes line up at the midpoint of the cell

Biology
Ecology - GeneralThere are no differences between the telophase cytokinesis in animal and plant cells True O False QUESTION 8 The plant pigment that provides yellow orange colors in plants is O Chlorophyll A O Carotene O Chlorophyll B O Melanin QUESTION 9 Most of the carbon that is incorporated into plants to give them mass and grow larger comes from O Carbon in the soil O Water O The sun

Biology
BiomoleculesIf a solid line represents a covalent bond and a dotted line represents intermolecular attraction which of the choices shows a hydrogen bond H N H O H H H H OH CH3

Biology
Ecology - GeneralThe energy that supplies all living systems on earth ultimately comes from what QUESTION 11 The alcohol during the DNA extraction is used to separate the DNA from all of the other components of the cell O True False QUESTION 12 In a molecule of chlorophyll O Gold O Lithium Iron is the element in the middle of the molecule

Biology
Cell: The Unit of LifeQUESTION 3 The chemical bond connecting one nucleotide with the next along one strand of a DNA molecule is called a glycosidic bond O hydrogen bond O phosphate bond O phosphodiester bond O peptide bond QUESTION 4 Chargaff s rules for the pairing of nitrogen bases is OA C and G T O A T and G C 04 6 and C T

Biology
BiomoleculesAs the two strands of DNA are unraveled which enzyme relieves the strain on the two strands O DNA polymerase O DNA ligase O DNA gyrase DNA endonuclease ODNA exonuclease QUESTION 2 Which is not a component of nucleic acids O organic nitrogenous base O pentose sugar Ophosphate sulfur

Biology
Cell: The Unit of LifeIf 16 of the nucleotides in one strand of a DNA molecule contain the base G what percent of the nucleotides on the complementary strand will also contain the base G O 16 O 8 O 34 32 O Impossible to determine from the information given QUESTION 24 Genetic analysis indicates that an unknown organism contains a gene that codes for a defective form of telomerase Based on this information alone you can conclude that this organism O is prokaryotic Ois eukaryotic O has unusually long telomeres O has an increased risk of developing cancer

Biology
Biotechnology & its ApplicationsIn eukaryotes translation takes place O on the plasma membrane O inside the nucleus Oon ribosomes O on the nuclear membrane on spliceosomes QUESTION 36 Ribosomes are complex aggregates of ORNA and DNA O RNA and proteins ORNA and sugars O DNA and proteins O nucleosomes and RNA

Biology
The Living WorldThe tRNA nucleotide sequence that pairs with bases on the mRNA is called a n intron O exon O codon O initiation factor Q anticodon QUESTION 40 When a polypeptide is being assembled the bond that forms between a newly added amino acid and the previous amino acid in the chaim a bond O hydrogen O hydrophobic O terminal O phosphodiester

Biology
Molecular Basis of InheritanceWhich base in an anticodon will pair with the base adenine in a codon O thymine O cytosine O guanine Ouracil QUESTION 34 A codon is composed of how many bases O one O two Othree O four GA

Biology
BiomoleculesWho proposed that the structure of DNA is a double helix with two polynucleotide chains running in opposite directions and held together by hydrogen bonding between pairs of nitrogenous bases O Hershey and Chase O Chargaff O Franklin O Watson and Crick O Meselson and Stahl QUESTION 18 Deoxyribose has a carbon atom that is not part of the pentose ring In a nucleotide what is attached to this carbon O a nitrogenous base O a phosphate group O three hydrogen atoms

Biology
Biotechnology & its ApplicationsIn eukaryotic cells transcription occurs on the surface of the nuclear membrane on ribosomes on spliceosomes inside the nucleus on the surface of the plasma membrane QUESTION 38 During replication sequencing transcription translocation translation nucleotide sequence information is changed into amino acid sequence informat

Biology
The Living WorldAn organism has been found to contain a defective form of photolyase What function might be impaired in this organism r Lengthening of the tips of chromosomes Repair of DNA damage caused by UV light Stabilization of single stranded DNA during DNA replication Recognition of damaged DNA by the UvrABC complex QUESTION 26 The sequence of nucleotides in a DNA molecule is called the O protein ribosomal translation genetic amino acid code

Biology
Biotechnology & its ApplicationsQUESTION 29 The connection that exists between genes and hereditary traits is based on using the information encoded in genes to synthesize O codons O nucleotides O proteins O histones O complementary bases QUESTION 30 The one gene one enzyme hypothesis was proposed by O Watson and Crick O Griffith Garrod O Franklin Beadle and Tatum

Biology
Molecular Basis of InheritanceDuring translation amino acids are carried to the ribosome by O mRNA O tRNA O snRNA O rRNA O miRNA QUESTION 32 RNA polymerase synthesizes a molecule of RNA using DNA as a template During O mRNA splicing Otranslation O transcription O gene sequencing

Biology
Animal KingdomDuring transcription of mRNA in eukaryotes some sequences are cut out of the primary transcript and the remaining sequences are joined together This processing of mRNA is called O termination Otranslation O splicing O capping O elongation QUESTION 28 To remove noncoding sequences in the pre mRNA of eukaryotes multiple snRNPS combine with proteins to form a larger complex called the O5 cap Ointrosome Oribosome O spliceosome 03 poly A tail 2

Biology
Molecular Basis of InheritanceXeroderma pigmentosum XP is a rare autosomal recessive disorder Patients with XP exhibit a cellular hypersensitivity to ultraviolet UV radiation a high incidence of skin cancer and premature aging Based on these clinical characteristics what is the most likely cause for this disease defects in DNA repair defects in DNA replication lack of telomerase activity shortened telomeres QUESTION 22 If a mutation produced helicase that was unable to hydrolyze ATP DNA replication would be stopped speeded up unaffected more prone to errors