Biology Questions

Which of the following is the result of double fertilization OTwo diploid zygotes A diploid zygoe and a triploid endosperm A diploid zygote and a haploid endosperm Two haploid zygotes

In the garden peas studied by Mendel cells of the sporophyte have 14 chromosomes within each nucleus How many chromosomes should be in an endosperm nucleus in the garden pea 7 14 21

The seeds of a flowering plant consist of a n Select Select tissue endosperm The seed coat is Select em

Which statement about double fertilization in the angiosperms is true It refers to two bees depositing pollen on the same stigma It results in two fertilization events within the ovule It refers to two pollen tubes reaching the ovule at the same time and both fertilizing the egg It results in more than one seed being produced from a given flower

In a life cycle that shows alternation of generations the sporophyte produces haploid spores through Select while the gametophyte produces Select gametes through mitosis

You find a plant you have never seen before and notice the flowers are relatively small lack any odor and are relatively colorless The flower is most likely pollinated by flies hummingbirds bees the wind

Which of the following is true of fruits Select all that apply They are seed bearing They provide nutrition to the developing seeds They facilitate the dispersal of seeds All fruits have evolved to attract animals 4

Monoecious Black Walnut trees are a common tree in Central Pennsylvania their nuts are an important source of food for wildlife They flower in the spring This photo shows those flowers male and female lowers are found on the same tree Choose all of the terms below that apply to this plant Dioecious Synoecious Female flower Perfect flowers Male flower Imperfect flowers

Question 7 In seed plants the gametophyte plants 0 5 generation is more reduced than in seedless

Which of the following is a defining character for a nonvascular plant It is the only group that shows an alternation of generations The gametophyte is the prominent dominant stage There is no sporophyte stage The sporophyte is the prominent dominant stage

What are the NACE competencies Give me your idea about them and how they work for you

What are the NACE competencies Give me your idea about them and how they work for you

Write a conclusion about emotional intelligence Clifton strengths and NACE competencies and what is the best selfrefection about them

Intracellular receptor Hydrophilic ligand Transmembrane receptor Hydrophobic ligand Cytoplasm Extracellular environment Prov of 36 110010011001 FIT Next bo Signal transduction pathway Cellular response Signal transduction pathway Cellular response

2 In Drosophila an X linked mutation Bar eye B causes slit like eyes Wild type females X X and males X Y have round eyes Males with the B allele XBY and females homozygous for the B allele XBXB have slit like eyes Heterozygous females X XB have kidney bean shaped eyes What phenotypes in what ratios will occur in the F and F generation if a a bar eyed female is crossed with a round eyed male 3 points b a bar eyed male is crossed with a round eyed female 3 points

Where along the parent DNA strand does synthesis of the new DNA strand take place Select one a O b Forks are used to pop the replication bubbles O d Outside of the replication bubbles OC At the forks of the replication bubbles Only in areas were the DNA is zipped up

chromosome Some useful information orf is the origin of replication strand A and strand B are referring to the template strands for replication to the right of the origin of replication you ll have to use your imagination to picture the soon to be replicated new strands ori strand A strand B For each question below select from the options in A through D and the explain A if the word or phrase is associated with strand A only B if the word or phrase is associated with strand B only Bio285 F23 C if the word or phrase is associated with strand A and B D if the word or phrase is associated with neither strand A nor B Topic 9 Problem Set 1 Replication of this strand involves a single primer molecule ii Replication of this strand involves several primer molecules 3 end 15 end ui Replication of this strand does not need primer Francis

1 One form of night blindness the inability to see in low light levels is a sex linked trait in humans controlled by alleles on the X chromosome Normal color vision XN is dominant to night blindness X For this problem assume all individuals are cis gender and not intersex just to keep the genetics simpler A If a night blind man marries a woman with normal vision and they have a night blind son what are the genotypes of all three individuals 2 points B If the mother and father were to have more children what proportion of the girls would be expected to be nightblind Why 2

B Complete the following exercise 1 Make a concept map showing the different types of inheritance analyses

A Construct explanations for the following questions 1 Scientist use zebrafish to understand the processes of meiosis and cell differentiation In the process of a zebrafish zygote developing into a larva explain how one cell the zygote can differentiate into many cells to form an embryo 1 A dove has a diploid number of 16 chromosomes How many possible distributions of chromosomes can occur in the homologous pairs of a dove s gametes A 16 B 32 C 256 D 65 536 B Construct explanations for the following questions Describe how plants use sexual reproduction 2 SEPS Construct an explanation to describe the process having the greatest potential for genetic variability Lizards are able to lose their tails and regrow them by a process called epimorphic regeneration Explain the type of cellular process taking place in epimorphic regeneration

the utations in each of the mutants are recessive or dominant you creted partial diploid bacteria by introducing into mutant cells a plasmid carrying an intact copy of the entire WT operon and the I gene I P O Z Y A For each of these strains match the sugars in the medium with the expected levels of the enzyme galactosidase Gal The expression levels are high low and extremely low practically no activity The first experiment was your control where you introduced the plasmid into the WT strain The genotype of the host cell is to the left of the slash and the genotype of the introduced plasmid is to its right Host strain plasmid I P O Z Y A I P O Z Y A lactose glucose glucose and lactose Question 31 ISP O Z Y A I P O Z Y A glucose lactose Choose Choose Choose Choose Choose 3 pts

E When the primer in the middle is removed and filled in with DNA the fragments mu then be joined i Which type of enzyme fills in the DNA after the primer has been removed Explain A DNA polymerase fills in the DNA after the primer has been removed

D What is the primer s purpose and why do they need to be removed Explain

I P O ZY A I P O Z Y A glucose and lactose lactose glucose Question 33 I P OcZ Y A I P O Z Y A glucose and lactose lactose glucose Choose Choose Choose Choose Choose Choose

glucose and lactose lactose glucose Question 27 ISP O Z Y A repressor can t bind allolactose glucose lactose alunnee Choose Choose Choose Choose Choose

Question 9 SARS D The same region in the genome of virus isolated from a young otherwise healthy patient who exhibited particularly severe symptoms read 5 AAUUACCGUAUAGAUUGUUU 3 What is the mutant protein sequence select all possible answers H3N NYRIDCL coo H3N FLRYLYN coo H3N NYLYRLF coo O H N NY YRLF coo H3N NYRIDCF coo H3N NYRYRLF coo

SARS H What is the role of the signal peptide O It s an address it directs the translocation of the protein to the endoplasimic reticulum ER by binding to the signal recognition particle SRP which in turns binds to the SRP receptor on the membrane of the ER O It s a signal peptide it is cleaved exported out of the cell and function as a peptide hormone to alert the immune system that cells have been infected by a virus O It s a signal it is a signal for the cell to stop production of its own proteins and to divert its resources for the production of the viral proteins O It s a peptide it is it is catalyzing the formation of peptides bonds during the translation of the viral mRNA encoding it

Sketch models of the wildtype lac operon and the adjacent lacl gene and the mutant your friend created Indicate on your sketches the positions of the promoter the operator the structural genes lacz lacy lacA and the lacl gene Take a picture of the sketch and upload the file

has an intact WT normal repressor gene 1 and intact lac operon is labeled as I P O Z Y A where superscripted denotes a normal gene or control element A mutation in the specific gene or control element will be denotec by a different superscript In the next series of questions you will be presented with several E coli strains mutants or WT that were grown in medium containing either glucose lactose or both For each of these strains match the growth conditions with the expected levels of the enzyme galactosidase B Gal The expression levels to choose from are high low and no activity The first strain is the WT strain I P O Z Y A lactose glucose and lactose glucose Question 25 I P OcZ Y A point mutations in O glucose and lactose glucose high low no activity Choose Choose 3 pts

Amino acid residues 1 through 13 of the spike protein constitute its signal peptide The signal peptide s sequence is H N MFVFLVLLPLVSS coo What is the overall nature of the signal peptide It s positively charged It s hydrophobic It s negatively charged O It s hydrophilic but uncharged

You have generated several random mutations in this region One of them is 5 AAUUACCUAUAGAUUGUUU 3 What may be the mutant protein sequence Enter the single letter code for the amino acids For a stop codon if any enter STOP And fill subsequent blanks with N A For example if you the sequence you need to enter is M enter M N A N A N A N A

SARS C The Delta Variant of SARS COV2 sequence of the same region is 5 AAUUACCGGUAUAGAUUGUUU 3 What is the mutant protein sequence O H3N NYLYRLF coo H3N NYRYRLF coo H3N ID NTKN W coo H3N FLRYRYN coo H N NY YRLF coo H3N FLRYLYN coo H N FVLYVH coo

SARS B SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The original Wuhan isolate of SARS CoV2 RNA sequence of the spike protein includes the following segment 5 AAUUACCUGUAUAGAUUGUUU 3 What is the protein sequence encoded here The protein region encoded by this segment is at the top of the receptor binding domain of the spike protein and is shown as a yellow circle in the figure in Question SARS A H3N IDK coo H3N NYLYRLF coo H3N FLRYLYN coo

SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The spike glycoprotein is an integral membrane protein with a large extracellular N terminal domain a transmembrane domain and a smaller intercellular domain see figure Region encoded by the sequence in Question 1 200 3 600 Extracellular Domain 400 5666 Intracellular Domain Receptor binding Domain Out Transmembrane Domain The N terminal domain consist of amino acid residues 14 through 1213 inclusive How many nucleotides encode this domain m Esssssssssss 66666 in N terminus ional modifications

I P O ZY A deletion in the middle of Z glucose and lactose lactose glucose Question 29 I dp O Z Y A repressor can t bind to 0 glucose and lactose lactose glucose Question 30 Choose Choose Choose Choose Choose Choose To determine whether the mutations in each of the mutanto pr

Which of the following does not affect the amount of a certain protein synthesized in prokaryotic cells Mark the correct answer s mRNA processing Use of alternative sigma factors binding of repressors to operator sequences Transcription regulation Stabilization of the mRNA Inhibition of translation with miRNAs

Match the following mutations with the correct designation of its type i e dominant or recessive N 2 1 d 69 S Is Choose Choose Choose recessive dominant ICH V

It is found that the enzyme X hydrolase also known as formerlyknownastwitter hydrolase is accumulating in cells only when substance X is added to the medium This phenomenon is most likely an example of gene regulation O negative inducible O positive O positive negative O repressible

1 2 3 tus Signals beginning Signals end 4 5 6 7 8 9 10 11 12 11 Translation Transports amino acids 9 Complements codon 10 A Termination sequence B AUG C Ribosome D Template strand E mRNA F Coding strand G Anticodon H Polypeptide 1 Promoter J Codon K UGA UAA UAG Takes place 7 End product 8

1 2 3 5 6 8 9 10 letion Status Signals beginning 12 Signals end 11 Translation Transports amino acids 9 Complements codon 10 A Termination sequence B AUG C Ribosome D Template strand E mRNA F Coding strand G Anticodon H Polypeptide 1 Promoter J Codon K UGA UAA UAG Takes place 7 End product 8 6

Match the RNA function with the correct type of RNA Carries the message of DNA into the cytoplasm for ribosomal A rRNA processing B SRP RNA C snRNA D tRNA E Small RNA F mRNA Multiple types found in ribosomal subunits Carries amino acids to ribosomes to make proteins Processes pre mRNA Contains both protein and RNA found within RER Y Control of gene expression

In eukaryotic genes there are regions that are coded or expressed These are known as The non coding regions are known

Match the mutation with its most appropriate correct description If a portion of a chromosome is broken off and joined to another chromosome If a region of a chromosome is replicated within a chromosome When a portion of a chromosome is broken off then turned around and put back into the chromosome A nonsynonymous mutation that changes the required amino acid When a mutation changes a sequence of amino acids that are regular to a stop codon When the reading of bases is added to or reduced and changes the reading of correct amino acid sequences When a sequence of DNA is replicated three times found in Huntington s disease A Inversion B Translocation C Frameshift D Nonsense E Duplication F Triplet repeat expansion G Missense

1 What is the mode of inheritance in the pedigree chart above Dominant TO Recessive Codominance 80 166 I II III IV Carrier Incomplete dominance 2 What is the mode of inheritance in the pedigree chart above Carrier Sex Linked Incomplete Dominance KEY Does not have condition Has condition Carrier Multiple Alleles B Complete the following exercise 1 Make a concept map showing the different types of inheritance analyses

One pedigree shown below has a family with individuals affected by an autosomal recessive disorder The other has a family affected by an autosomal dominant disorder How do you know which is which Label each pedigree with its inheritance pattern and explain your answer REMEMBER If more individuals are affected it DOES NOT mean the disorder is caused by a dominant allele That is not a valid reason to use in your explanation 13 Inheritance Pattern 15 Inheritance Pattern I C Bethany Lou 2016 2 2 3 H How do you know 16 How do you know I II III 2 2

Assume in the questions below that the affected individual has an autosomal recessive disorder Use TO 2 I 1 2 I What is the genotype of I I 2 How do you know H II 2 1 2 7 What is the genotype of II 8 How do you know I II I 2 3 What is the genotype of II 4 How do you know Assume in the questions below that the affected individual has an autosomal dominant disorder Use B and b I 2 II 10 How do you know 2 2 9 What is the genotype of II 1 I II I 2 5 What is the genotype of I 2 6 How do you know 2 I II 2 1 2 II What is the genotype of I 1 12 How do you know

cilia microvilli flagella lamellipodia Question 46 1 point 4 Listen Sarin nerve gas paralyzes muscle by interfering with neuronal transmission by which of the following O Encephalin Serotonin CARA

end because it has a higher Tubulin addition happens preferentially at the affinity for tubulin heterodimers GTP hydrolysis acts as a molecular switch to microtubule affinity for addition of heterodimers minus increase plus increase plus decrease minus decrease

have a signal peptidase error do not make the appropriate anchor protein have a defect in ribosomal proteins that allow attachment to the surface are synthesizing cytoplasmic proteins Question 40 1 point Listen The axon branches of a typical neuron terminate at structures called glia Saved O the myelin sheath nodes of Ranvier

treadmilling catastrophe oligomerization Onucleation Question 16 1 point Saved 1 Listen Axonemal microtubules O are required to maintain axons maintain cell structure are part of the structure of cilia