Biological Classification Questions and Answers

In the tree below Taxon C forms a sister group with Taxa D E and F A B C D E F G H True False 5 3

In the tree below which groups form a monophyletic group clade A B C D E F G H D G and H C E and F C D E F and G A B C and D 1 5 3

5 Analysis of organelle genetic material shows a high similarity to the genetic material of Bacteria group What does indicate phylogenetically

3 Draw the structure of a basic Bacteria or Archaea cell and label the parts

Your research or guiding question should do what Select ALL that apply Should be of interest to you Should be a topic that can be analyzed lead to new insights Should be researched in scholarly peer reviewed journals

H Thymine enol form O Adenine O Cytosine O Uracil 0 H Which base will thymine enol pair with in DNA Guanine O Thymine NH a Cytosine b Uracil d Guanine H C H c Thymine NH e Adenine

Revertant colonies plate 1500 1000 500 O Missense mutations 20 O Frameshift mutations O Nonsense mutations TA 100 TA 1538 Guanine 40 60 80 100 Aflatoxin B dose ng O All except frameshift mutations Aflatoxin B The graph shows the results of an Ames test to identify the effect of several concentrations of Aflatoxin B using a couple of his Salmonella strains TA 100 and TA 1538 While TA 100 is a strain sensitive to reversion mutations by base substitutions TA 1538 is sensitive to frameshift mutations Based on the results what kind of mutations can Aflatoxin B1 lead to CH The TA 100 and TA 1538 are his Salmonella bacterial strains sensitive to 120 reversion mutations by base substitutions and frameshifts respectively Aflatoxin is a mutagen that binds to G bases and induces apurinic sites in DNA

Streaming media is a relatively new type of source compared to books and journal articles What citation component is new unique to this type of source O The URL of the media to help locate it O A DOI or digital object identifier A designation indicating the format of the media such as a video file O Nothing is new media citations include the exact same components as books and articles

There are 2 common options for in text citations in APA Select the correct 2 options below Author s last name and date shown in parentheses at the end of the sentence Author s last name and page number of information shown in parentheses at the end of the sentence Author s last name in the body of the sentence followed by the page number in parentheses Author s last name in the body of the sentence followed by the date in parentheses Author followe You sel

1 0 0375 A three point test cross revealed a total of 11 double crossovers among a total of 726 test cross progeny Using the genetic map provided calculate the coefficient of Interference 1 1 0 015 01 0 4 1 0 6 15 CM O 1 1 25 CM f

When Darwin proposed natural selection in 1859 it was met with a lot of skepticism Criticisms centered on three issues time the fossil record inheritance In a short essay address one of these criticisms Describe why it was a justified criticism and then how later scientific work showed that it wasn t a problem after all

Match the explanation for the origins of fossils with the correct description neoplatonism organic origin scala naturae fossils are part of a natural fix the vis plastica force shapes f v fossils are the remains of

Which of the following is a possible cause of a mutation errors during cell division environmental agents chemicals all of the above

Which term refers to a chromosomal abnormality in which there are three homologous chromosomes in place of a homologous pair zygote trisomy monosomy tetrad

Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue detailed information about the structure organization and function of the complete set of hum genes the process of determining the precise order of nucleotides within a DNA molecule

13 Cells in your pancreas make insulin Insulin is a protein that helps regulate blood sugar The cells release insulin into the bloodstream Describe the steps of how the cells make process and release this protein Start with the ribosome and end with exocytosis through the membrane

6 The picture below represents diffusion Write one sentence to describe what is happening in the picture high concentration solute low concentration voeris toe

Briefly describe the four types of tissue

Why do multicellular organisms need specialized cells

Describe the process of cell differentiation

Which of the following is NOT a reason why some researchers might group Neandethals and humans Homo sapiens together as a single species check your answer in Section 1 and in all of Section 5 Genetic evidence suggests Neanderthals and early modern humans could and did interbreed and reproduce Morphologically neanderthals have an occipital bun and large brow ridge just like humans O Phylogenetically Neanderthals and humans share a common ancestor Homo heidelbergensis

The grandmother hypothesis suggests that living into old age and caring for grandchildren rather than continuing to reproduce is naturally selected for which means check your answers in section 4 and 1 O living into old age would need to be inheritable O all of these O not all humans will live into old age O living into old age but focusing on grandchildren rather than continuing to reproduce oneself would still increase reproductive cuccors and inclusive fitners

Humans and our ancestors have spent the majority of their prehistory living Check your answer in section 4 and section 5 O as hunter gatherers as agriculturalists or farmers O in large cities such as Ur O in social isolation and adapting to that lifestyl

In Drosophila the hunchback gene encodes a protein HB that is required in the correct concentrations for proper segmentation of the embryo In the zygote and embryo the expression of hunchback is stimulated by high concentrations of Bicoid protein You manipulate a Drosophila embryo to have high Bicoid concentrations throughout Which of the following would occur The HB protein would not be produced at all and segmentation would not occur correctly O The HB protein would be produced throughout the entire embryo and segmentation would not occur correctly O The HB protein would not be produced at all Segmentation would not occur correctly O The HB protein would be produced throughout the entire embryo

The heart cardiovascular system kidneys and gonads originae from which of the germ layers ectoderm endoderm mesoderm

From earliest to latest the overall sequence of early development proceeds as follows OA gastrulation organogenesis cleavage formation of the blastula B ovulation gastrulation fertilization C cleavage gastrulation organogenesis D gastrulation blastulation neurulation

2 In a cross between two heterozygotes Aa the next generation will be A all homozygotes B in the ratio 1 3 heterozygotes to homozygotes C in the ratio 1 1 homozygotes to heterozygotes D all heterozygotes in the ratio E 1 3 homozygotes to heterozygotes

5 An individual with naturally curly hair and an individual with naturally straight hair mate all of the offspring have naturally wavy hair What is the relationship between the alleles for hair texture A pleiotropy B incomplete dominance C straight hair and curly hair are sex linked but wavy hair is not D wavy hair is dominant to both straight and curly hair E codominance

5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows

Keynesian Economics does NOT argue that the government has to balance its budget to minimize the crowding out effects an attempt by the economy as a whole to increase aggregate savings not only will not succeed but may lower aggregate output income and employment fiscal and monetary policies are necessary to stabilize an economy O the State government which many see as a slow boring entity is really one of our most exciting risk takers

Which of the followings does NOT describe Universal Basin Income it would be less inflationary than Job Guarantee Program it is paid without any qualification tests or a requirement to work it is cash payment at regular intervals and recipients can use the cash for any purposes it would allow recipients to pursue what they want to do without worrying about their survival

Which of the following events would most likely reduce aggregate demand a negative pessimistic consumer expectation a reduction in business and personal tax rates an increase in expected profits on investment a reduction in the amount of existing capital stock

If there is a decrease in interest rates the long run result is an increase in the price level only an increase in real GDP and the price level no change in real GDP and the price level an increase in the price level and no change in real GDP

There will be unemployment in a labor market if there are perfectly flexible wages there is no minimum wage the current wage is above the equilibrium wage the current wage is below the equilibrium wage

An increase in investment and government purchases can be expected to shift the aggregate demand curve to the left lead to movement up along the aggregate demand curve Olead to movement down along the aggregate demand curve shift the aggregate demand curve to the right

Homologous chromosomes linked by a centromere have different parental origins Answer Bank Sister chromatids result of chromosome duplication may have different alleles

Learning What are the functions of mitotic cell division replacement of cells asexual reproduction growth of multicellular organisms production of eggs or sperm

Macmillan Learn Transcription Answer Bank Translation

ch amino acid in a protein is encoded by a group of three nucleotides known as a codon Use the codon table to match mRNA lons and the resulting amino acid sequence mRNA sequence amino acid sequence AUG pro UGC phe leu

Can you write a takehome message about what you learned about career service

RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3

Genetic variation is created by the direct action of natural selection arises in response to changes in the environment tends to be reduced when diploid organisms produce gametes must be present in a population before natural selection can act upon the population

The two strands of a DNA molecule contain nitrogen bases which are O identical O parallel complementary O proportionate O random QUESTION 8 Replication of DNA is conservative O redundant dispersive O semiconservative semidispersive

a protozoa b Protista c prokaryote d eukaryote e Gymnospermae f fungi g domain h Bacteria Open with Google Docs 1 Archaea j Eukarya Definition 1 kingdom of single celled eukaryote organisms such as protozoa 2 organism whose cells have nuclei 3 original name of the kingdom that included all bacteria 4 kingdom of eukaryote organisms such as mushrooms and molds 5 domain that was formerly the Archaebacteria kingdom 6 single celled organisms that can move on their own 7 domain that includes all four eukaryote kingdoms 8 is a vascular plant that produces seeds in special structures called cones

Protista prokaryote eukaryote Gymnospermae fungi domain Bacteria Archaea

A n eukaryote is a single celled organism that does not contain membrane bound organelles O O False True

A n genus is a taxonomic level consisting of a group of similar species O True False 1 poin

The variety and number of life forms on Earth is called hybridization O True O False

What organism is shown in this figure Olichen mould mushroom O yeast green algae hyphae

Which term describes a round bacterial cell O pathogen O spirillum bacillus COCCUS