Biotechnology & its Applications Questions and Answers

Question 2 How would the research team cut the human DNA gene and open the plasm human cell DNA nucleus insulin gene

Quiz question Randomly pick a F2 yellow round seed and self fertilize what phenotypes will their progeny have A 1 16 of F2 will have all yellow round progeny 2 16 of F2 will have 3 4 yellow round progeny and 1 4 yellow wrinkled progeny B 1 9 of F2 will have all yellow round progeny 2 9 of F2 will have 1 2 yellow round progeny and 1 2 yellow wrinkled progeny C 1 9 of F2 will have all yellow round progeny 2 9 of F2 will have 3 4 yellow round progeny and 1 4 yellow wrinkled progeny D 1 16 of F2 will have all yellow round progeny 2 16 of F2 will have 1 2 yellow round progeny and 1 2 yelloy wrinkled progeny

Biology 1 Ce Joe s mother has Huntington s diseas genotype His father does not have t

Read the paragraph Jan looks forward to the family reunion each year Family members gather at a lake for a big picnic Jan especially enjoys spending time with her cousin Sarah They go swimming and spend hours talking about the latest books they have read They connect with each other Which meaning of connect is used in the paragraph 1 to join things together 2 to log on to the Internet 3 to get along with someone 4 to make a good baseball hit

Bret admired the toy garage he had built for his brother However he noticed that one wall did not tightly He knew he would have to reinforce the spot where the wall met the roof Bret added more glue to the area and felt certain this adjustment would make the garage sturdy enough to stand up to the rough playing it would receive from his little brother What does the word reinforce mean in the passage 1 move slightly O2 take or pull apart 3 examine carefully 4 fortify or make stronger

Question 4 Points 2 The Congress has limitations on its power to tax Which among these is not one of those limitations O Congress may not levy a poll tax Congress may tax only for public purposes O Congress may not tax imports Congress may lay indirect taxes but all of them must be at the same rate in every part of the country Complete Later Complete

How many carbonyl groups are required to resolve a potassium ion in the selectivity filter of the K ion channel Oa g b 2 OC 4 O d 3 Oe 1

14 A Who are the Sixers The Sixers a team of 1 01 Corporation workers are pitted against the High Five in the OASIS Easter egg hunt and are renowned for their technological prowess and cruelty Their employee identification numbers which all start with the number six are where they get their moniker B Explain how they got their name The Sixers appearance emphasizes their status as employees of a major corporation rather than as individuals with unique identities They are anonymous and wear uniforms Also it makes them appear more formidable and well prepared as competitors in the Easter egg search which serves to terrify their rivals

What type of transport can proceed against a concentration gradient Oa passive transport Oblateral diffusion Oc C simple diffusion Od facilitated diffusion e active transport

Which of the following is not a typical reagent in a standard polymerase chain reaction Ca DNA polymerase O b Oligonucleotide primers O c DNA ligase O d dNTPs Oe Template DNA

Some aminoacyl tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity The tRNAs for alanine apparently fall into this category Ala What feature of tRNA does Ala tRNA synthetase recognize the acceptor stem and anticodon loop 3 70 G U base pair in the acceptor stem Darm TYC arm Ala What is the consequence of a C G mutation in the third position of the anticodon of tRNA Alanine inserts at codons encoding proline No changes occur because the anticodon does not specify alanine binding Proline inserts at codons encoding alanine No changes occur due to the wobble effect

millan Learning Translate the mRNA starting at the first 5 nucleotide assuming that translation occurs in an E coli cell 5 AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA 3 Enter the sequence using the one letter amino acid codes amino acid sequence If all tRNAs make maximum use of wobble rules but do not contain inosine how many distinct tRNAs are required to translat this RNA required number of distinct tRNAS

What does DNA provide the code for nitrogenous base pairing protein synthesis deoxyribose formation nucleotide synthesis

Each of the following target bacterial ribosomes except polymyxins erythromycin tetracycline

This shark is O a male Ob both male and female Oc female d IL

Find two countries that are high in world energy consumption and two that are significantly lower 4 countries total Include pictures on a map of your countries What factors contribute to high energy consumption What factors contribute to low energy consumption

Match the homozygous heterozygous and hemizygous phenotypes to their descriptions Having two different alleles for a given gene on the homologous chromosome Having two identical alleles for a given gene on the homologous chromosome Presence of only one allele for a characteristic as in x linkage Homozygous Hemizygous Heterozygous

We know from the relative amounts of 160 and 180 that global temperatures and global climate have changed over time Why is it important for scientists to be able to explain how they know that climate has changed over time and that they are able to repeat experiments that support this information Data from experiments is needed to prove scientists right Research must be supported by evidence and repeatable with consistent results to be science Conducting research helps scientists justify their funding Scientists are financially supported to demonstrate that climate change is natural not manmade

QUESTION 4 The illustration below shows the changes in the membrane potential of a neur membrane potential that triggers the opening of the voltage gated Na channe membrane potential mV 40 40 a b

Mueller Hinton agar needs to be made to specific standards in order to yield re reproducible results How deep is the agar on a Mueller Hinton agar plate O a 2 mm b 4 mm c 6 mm d 8 mm

3 If a cell extract is thought to contain a specific protein how might a technician check to see if the protein is present 4 Besides using the Ti plasmid name another way that foreign genes might be transferred to plant cells

How many kilometers in 101 miles Round to one decimal place 101 miles km

Mammals cannot normally regenerate lost limbs However if the p21 protein is missing in mice the mice can regenerate lost limbs What does this tell us about the role of p21 All of these The absence of p21 could potentially result in uncontrolled cell growth and the production of cancerous tumors The presence of p21 plays an important role in inhibiting the cell cycle when present The presence of p21 is essential to the normal growth of cells

Question 7 Points 1 Why are elections so critical to the democratic process O Elections give the power to the people O Elections force political parties to spend large amounts of money O Elections always produce the best choice for the times O Elections can be easily manipulated

3 Complete the table for the 3 steps involved in cellular respiration Name of step Where does it occur in the cell With or without oxygen of ATP molecules produced

Question 1 What is one f

Connections to biology 5 Ribozymes are RNA polymers that are found to catalyze a number of important biochemical reactions similar to protein enzymes Among the most common reactions they catalyze is the cleavage of RNA polymers One potential mechanism by which they catalyze the cleavage of the RNA backbone is shown in the figure to the right where the ribozyme uses a base X to facilitate nucleophilic attack of an alcohol group and an acidic group Y H to facilitate the leaving group ability of the alcohol attached to the ribose B O O H B O OH Y H De B O OH I m 1 he 0 9 0 O A H O B b Would you predict the change in entropy AS to be positive negative or negligible for this reaction OH a Is the mechanism shown an example of a concerted addition elimination or elimination addition type c Would you predict the presence of the ribozyme to increase make more positive decrease make more negative or not affect the change in free energy AG of this reaction

Select the statements that are true in the context of any of the G phases Skin cells are an example of a cell that is permanently in the G phase The G phase is a stage of non division A cell may enter the G phase following cytokinesis A cell that enters the G phase can never divide again

All of the statements below about epigenetics are correct EXCEPT choose the incorrect statement O Epigenetic modifications are essential for differentiation of embryonic cells into specialized cells and tissues O Epigenetic modifications primarily induce changes to the genetic code itself A C G T O Epigenetic modifications occur in response to both positive and negative environmental exposures and experiences O Epigenetic modifications can occur throughout the lifespan O Epigenetic modifications are reversible but tend to persist in a cell

Imagine you are a researcher assessing DNA methylation patterns of genes important for physiological stress responses You discover that the promoter region of a gene known as NR3C1 highly methylated in those who experienced early life stress Based on this information what do you predict O Expression of the Nr3C1 gene is likely promoted unless the histones are also acetylated O Expression of the NR3C1 gene is likely unaffected by DNA methylation altogether Expression of the NR3C1 gene is likely repressed and or very low in these individuals O Expression of the NR3C1 gene is likely promoted and or very high in these individuals

Bat echolocation allows them to detect objects in the dark moths have ears which can detect ultrasound echolocation calls Scientists have argued that this relationship is both co evolution and an arms race Using bats and moths as a model explain what sort of co evolution this is and what we mean by an arms race Here are three answer versions Two are created by chatGPT One is created by me I d give chatGPT a C grade on both of its answers and myself a B or A Your task is to read all three and then explain which one is best and why Answer 1 The co evolution between bats and moths is a classic example of predator prey co evolution Bats have evolved the ability to use echolocation to navigate and locate prey while moths have evolved ears that can detect the high frequency sounds produced by bats allowing them to avoid being captured An arms race is a term used to describe a situation where two or more species evolve in response to each other s adaptations resulting in an escalation of traits that provide an advantage in the struggle for survival In the case of bats and moths this has resulted in an evolutionary arms race with each species evolving increasingly sophisticated adaptations in response to the other s adaptations As bats evolved more sophisticated echolocation abilities moths evolved more sensitive ears that could detect the high frequency sounds produced by bats allowing them to avoid being detected In response bats evolved more complex echolocation calls which made it harder for moths to avoid being detected This process has continued over millions of years with bats and moths evolving increasingly sophisticated adaptations in an ongoing arms race In summary the co evolution between bats and moths is an arms race where each species has evolved adaptations in response to the other s adaptations resulting in an ongoing escalation of traits that provide an advantage in the struggle for survival Answer 2 The co evolution between bats and moths is a classic example of predator prey co evolution Bats use echolocation to detect prey such as moths in the dark and moths have evolved to detect the echolocation calls of bats and evade them The arms race aspect of this co evolution refers to the continual adaptation and counter adaptation between the predator and prey As bats evolve to better detect moths moths in turn evolve to evade detection This leads to a back and forth escalation of adaptations with each species trying to gain an advantage over the other For example some species of moths have evolved ears that can detect the echolocation calls of bats and respond with their own ultrasound clicks effectively jamming the bat s detection system Meanwhile some species of bats have evolved to produce echolocation calls at higher frequencies making it harder for moths to detect them Overall the co evolutionary relationship between bats and moths is an ongoing arms race with each continual cycle of adaptation and counter adaptation

Which of the following bacterial concentrations would produce a TFTC plate at the 10 dilution Consider you plated 1mL of the bacterial suspension 2 10 organisms ml 2 x 10 organisms ml 2 x 10 organisms ml 2 x 10 organisms ml

To genetically transform an entire organism you must insert the new gene into every cell in the organism Which organism is better suited for total genetic transformation one composed of many cells or one composed of a single cell Explain

DNA has been loaded onto an agarose gel a Does DNA carry an overall positive neutral or negative charge b When placed in the gel box DNA migrates toward which electrode c Does DNA fragment size have an effect on how fast DNA migrates through a gel Explain d Why are we able to see DNA fragments in the gel when it is exposed to UV light

ourses SC BIOL1000 N Biology I Cel Consider the following unknown sequ 5 GATCGGAATTC3 1 List the functional group present

Dashboard My courses SC BIOL1000 N Biology I Cells Molecular Biolog

Which of the following resistance mechanisms describes the function of lactamase O Target mimicry O Target modification Efflux pumps Drug inactivation

2 The dimensions of the synaptonemal complex are similar in different organisms but the amino acid sequences of proteins that make up the central element the rungs of the ladder are not similar What does this suggest has been the evolutionarily important feature of the synaptonemal complex

2 concentration is the diffusion of water across a semipermeable membrane 3 What type of tubing is used in this experiment 4 What vegetable is placed in the hypertonic and hypotonic solutions BJECTIVES Understand the concepts and differences between selective permeability active vs passive transport diffusion and osmosis Describe the movement of water across the plasma membrane when a cell is surrounded by a hypotonic hypertonic or isotonic solution Understand the effect of temperature on diffusion rate Understand the effect of solutes complexity or molecular size on the rate of osmosis or membrane permeability respectively NTRODUCTION mportant Terms Solute A substance dissolved in a solution Solvent The liquid in which a solute is dissolved to form a solution Concentration gradient The gradual difference in concentration of a dissolved substance solute in a solution between a region of high density and one of lower density Cells must exchange nutrients wastes and gases with their surroundings The plasma membrane is sometimes called the cell s gatekeeper since it controls the movement of substa into and out of cells The plasma membrane can act as a gatekeeper because of its selective permeability Selective permeability means the membrane will allow some substances to pass across but it will prevent the movement of other substances There are two basic types of movement across the

ch of the following is true about Alu Oit codes for proteins Oit reproduces itself Oit inserts itself in the same location it originates found in fish genome Question 5 1 point

Itranscript Experiments with Germ free Animals Please select the conclusions of studies comparing the health of germ free Check All That Apply Normal microbiota are a source of some vitamins

The annual inspection certificate should be located on the of the BSC

What color is an acid fast bacteria Blue Purple Red

An advantage of walk in hoods is that Select one an employee may walk into the hood to set up the equipment O an employee may walk into the hood to check the flow of air O an employee may walk into the hood to check on experiments an employee may walk into the hood to deal with hazardous waste

All of the following FUME HOODS are permitted on FIU s campuses except Select one Recirculating Fume Hood O16lls in

Contaminated air exits the hood through the Select one O sash opening O baffles

Formaldehyde and benzene are examples of chemicals categorized under O Hazards not otherwise classified O Physical hazards O Health hazards O Mental hazards

1 18 21 24 Question 26 1 point Mr Bean is going to take a three month vacation from h Statistics counts Mr Bean as unemployed and in the labor force a discouraged worker employed and in the labor force

5 AGGCCTAGCACCCTA 3 3 TCCGGATCGTGGGAT 5 Primers 5 GCC 3 and 5 TGG 3

Question 7 Points 1 How long does a state have to ratify an amendment O 3 years O 5 years O 7 years O 10 years