Biotechnology & its Applications Questions and Answers

True or False The Library Search Box option DATABASES provides a mechanism for finding library research databases alphabetically by title but NOT by subject O True False

You need resource recommendations for the field of genetics Which type of library guide should you try to find O Course O How To Current Topics

A research or guiding question can be viewed through academic disciplinary lenses Which lens would best match this question How can society alleviate the issue of drug addiction O Sociology O Business O Criminal Justice Education

The purpose of a good research or guiding question is what Select ALL that apply Involve a significant issue Help you focus and narrow your research Be relatable to others O Lead to analysis and conclusions

socialism could only emerge in developed leaders communist capitalist economies Deng argued his policies were necessary as China still had feudal hang overs However such policies began a still on going debate about whether China has now become a capitalist country in all but name was based on the concept of economics in control Deng s approach rather than the Maoist idea of politics in control In other words had was more important than political dogma or economic pragmatism Practice versus Whatever In September 1982 the 12th Congress of the CCP approved Deng s economic plans as well as various personnel changes He was then in a position to introduce the second phase of his plans for industry DISCUSSION POINT Do you think that Deng s use of market mechanisms and allowing the existence of privately owned firms and enterprises automatically meant that China was likely to become a fully developed capitalist economy To discuss this in any depth you will need to do some research on key terminology and definitions such as capitalism socialism and market mechanisms Industry phase 2 1984 89 In October 1984 the Resolution on the Reform of the Economic System began Phase 2 This further reduced state control over enterprises though they still remained under public ownership Deng also made it clear that unprofitable enterprises would be closed down To make profits easier the state tax on enterprise profits was reduced from 55 to 33 in 1983 84 This emphasised that ownership and management were two separate aspects and that managers could be given some freedom in selecting ways to improve production In particular it allowed private groups to lease small and medium sized enterprises though the largest ones remained under direct government control The government also introduced a legal framework that protected private investment This as As the

How long would the peptide be that is translated from this mRNA sequence 5 AUGGGCUACCGA 3 O0 amino acids O 3 amino acids 2 amino acids 4 amino acids

No GFP 100 25 10 4 2 Counts Counts Counts Counts 50 100 0 10 Counts 50 0 10 100 50 100 0 10 10 50 10 100 10 0 10 10 50 0 1 10 GFP 87 77 10 GFP 10 10 GFP 82 83 10 104 10 104 81 21 104 10 10 GFP 73 13 104 0 10 10 10 10 104 GFP Figure S11 Transfection Efficiency of the PLAT E Cells and pMX System We transfected the GFP expressing retroviral vector and the control vector at ratios of 1 0 1 3 1 9 and 1 23 into MEFs with a constant amount of total DNA Forty eight hours later cells were photographed under a fluorescence microscope and analyzed by flow cytometry Bars indicate 200 m The analysis showed that 88 83 81 and 73 of transfected cells expressed GFP the mean GFP fluorescence being weaker with decreased concentration of the GFP expressing vector This indicates that 47 0 83 12 0 81 and 0 05 0 7324 of cells transfected with the four 10 or 24 factors expressed all the factors respectively In a 100 mm dish we plated 8 x 105 cells of which 4 x 10 cells should express all the four selected

Unit Chemical Writing Formula Equations WS 1 Directions Convert the following word equations into formula equations by changing element and compound names into chemical formulas 1 sodium oxygen sodium oxide 2 copper silver nitrate copper II nitrate silver 3 aluminum chlorate barium sulfate aluminum sulfate barium chlorate 4 bromine calcium iodide calcium bromide iodine 5 zinc sulfide magnesium arsenate zinc arsenate magnesium sulfide 6 cobalt lead II nitrite cobalt III nitrite lead muptorpotassium hydroxide hydrogen qmsx3

4 Ionic compounds In the chart below write the ionic formula if it gives you the ionic compound name Write the ionic compound name if it gives you the formula lonic Compound Name Iron III chloride Ammonium phosphate Tin IV sulfate Potassium perchlorate Aluminum hydroxide Sodium chloride Calcium fluoride Potassium bromide Magnesium carbonate Formula lonic Compound Name Formula NaF Bel2 Al2O3 FeF3 PbO CaSO3 Ba3 PO4 2 NH4 2CO2 Cul2

Gene therapy detailed information about the structure organization and function of the complete set of human genes the process of determining the precise order of nucleotides within a DNA molecule aims to treat a disease by replacing mutated or defective gene with a functional allele process of cultivating cells and tissues outside the body of an organism in vitro in an artificial

Sexual Isolati 2 5 15 1 0 5 A B Same Hosts ecologically similar Based on the graph which of the following predictions can be made regarding the ecological speciation of both types of he An ecologically similar pair of population exhibits greater reproductive isolation increased level of gene flow population C Different Hosts ecologically diverse Type of Population Pair An ecologically diverse pair of population exhibits a lower reproductive isolation decreased level of gene flo population An ecologically similar pair of population exhibits a lower reproductive isolation decreased level of gene flow population

Draw a diagram that illustrates the experimental design described in this excerpt Induced Pluripotent Stem Cell Lines Derived from Human Somatic Cells To identify candidate reprogramming factors we compiled a list of genes with enriched expression in human ES cells relative to that of other cell types and prioritized the list based on known involvement in the establishment or maintenance of pluripotency We then cloned these genes into a lentiviral vector to screen for combinations of genes that could reprogram the differentiated derivatives of an OCT4 knock in human ES cell line generated through homologous recombination In this cell line the expression of neomycin phosphotransferase which makes cells resistant to geneticin is driven by an endogenous OCT4 promoter a gene that is highly expressed in pluripotent cells but not in differentiated cells Thus reprogramming events reactivating the OCT4 promoter

Humans are direct descendants of chimpanzees This is one of the problems with studying evolution none of the other modern primates have their own fossil records to trait their evolution Check your answer in section 5 O True False

The key differences between cell types that allows them to be differentiated from one another are the result of O the DNA present in the nucleus of each cell type differential sorting of chromosomes during mitosis when the cells are dividing the rate of gene expression in different cell types varying density of RNA polymerase to produce more mRNA in some cells than others O the proteins being produced in each cell type transcription factors regulating which genes are expressed and their level of expression O the amount of protein present in different cell types varying density of ribosomes to produce more polypeptides in some cells than others

Nurse cells transcribe bicoid mRNA and then transport it to the embryo O translate bicoid mRNA into protein transport Bicoid protein to the embryo induce the embryo to transcribe and translate bicoid mRNA translate bicoid mRNA into protein and transport the protein to the embryo

By what mechanism canCRISPR Cas technology introduce a point mutation into a gene O A double crossover replaces DNA cut by Cas9 with a donor DNA O The double strand break made by Cas9 is repaired by end joining O The single guide RNA is incorporated into the eukaryotic genome by Cas9 O The activity of Cas9 changes the DNA sequence of its target

You cut a plasmid with a restriction enzyme that cuts it into three pieces one fragmentis 240 base pairs one fragmentis 600 base pairs and one fragment is 1200 base pairs You carry out electrophoresis of the digested sample Which of the fragments will be closer to the top of the gel where the sample was inserted O It depends on the charge of the DNA fragment O They will all be near the top because they all have sticky ends O The 240 base pair fragment The 600 base pair fragment O The 1200 base pair fragment

Which stretch of double stranded DNA is most likely to be recognized as a restriction enzyme cutting site O 5 TCGGCT 3 3 TCGGCT 5 O 5 ACCCCT 3 3 TGGGGA 5 O 5 TCCGGA 3 3 AGGCCT 5 5 GAATCG 3 3 CTTAGC 5 5 GTTCAT 3 3 CAAGTA 5

Restriction enzymes are invaluable tools in gene cloning because O they replicate the DNA of interest they cut at specific sites within the DNA and produce sticky ends allowing DNA from different sources to be joined together O they replicate the gene of interest they cut at specific sites within the DNA and produce sticky ends allowing DNA from different sources to be joined together they can produce sticky ends so DNA from different sources can be joined together they cut both strands of DNA at specific sites

When you do a Bradford Assay and create a standard curve of absorbance at 595 nm for known protein concentrations the formula of the regression line y mx b can be used to calculate of unknown protein samples if you perform a Bradford Assay on the unknown protein samples Look back at the graphing examples in class assignment and the Labster pipetting simulation concentration absorbance slope dilution

Taring refers to A using a weigh boat B setting the balance to zero C calibrating the balance for accuracy D both A and B

Cells move to new positions as an embryo establishes its three germ tissue layers during A determination OB cleavage C fertilization E gastrulation

A Punnett square is a diagram of an individual s ancestors used in human genetics to analyze the Mendelian inheritance of a certain trait O True O False

How many alleles do your cells have for each gene 2 4 O 1 3

Transgenic Bt crops have been genetically modified to O produce an insecticide O be tolerant of salt in the soil O have increased protein content Resistance to common herbicide

8 Transgenic plants produced by biotechnology contain fewer introduced genes than altered plants obtained by traditional breeding methods True

he Burning of our House ly 10th 1666 y Anne Bradstreet I took ot look nd ring noise dreadful voice Firel and Firel desire did spy rt did cry Distress uccourless da space laco What is another way to write the highlighted line 2 without using inverted syntax A For sorrow near looked not I B I looked not for sorrow near C I did not look for sorrow near

6 What is one concern with the use of genetically engineered herbicide tolerant crops decreased yields potential allergic reactions transfer of herbicide resistance to weeds a b C d D loss of genetic diversity expense of using herbicides

Congress passage of new laws significantly increasing the regulation of business would tend to shift the aggregate demand curve to the left shift the aggregate demand curve to the right shift the aggregate supply curve to the left shift the aggregate supply curve to the right

The economy is currently going through high unemployment Which fiscal policy recommendation will help return the economy to the full employment decrease the money supply decrease government spending increase interest rates decrease personal income taxes

4 Transgenic Bt crops have been genetically modified to resist common herbicides have increased protein content produce an insecticide be tolerant of salt in the soil grow faster a b C d e

1 What is the name of the DNA polymerase in the method 1 pt 2 What is the scientific name of the bacterium that produces the enzyme Use proper nomenclature 1 pt 3 What does denaturation in this process accomplish Explain 2 pts 35 5 denaturation at 95 C 3 5 annealing Primer 1 at 50 C extension at 72 C Cycle 1 double stranded DNA 2 copies of DNA Primer 2 53 5 3 DNA polymerase Primer 1 Cycle 2 DNA polymerase Primer 2 DNA polymerase Cycle 3 Cycle 4

Can you write a takehome message about career service

Can you write a takehome message about career service

The division of a O cell wall develops cracks around the equator of the cell O chromosomes are pulled toward the ends of the cell O actin and microtubules constrict the cytoplasm O new membrane and cell wall materials begin to grow and form a septum QUESTION 42 These structures are held together by cohesin O Nucleosomes O Sister chromatids O Homologous chromosomes O Solenoids

Based on hierarchical levels of biological organization which of these choices represents the broadest level O Endocrine system O3 toed sloths O School of piranhas O Amazon Basin O Jaguars giant anteaters macaws capybaras QUESTION 2 Experiments are carried out to test a hypothesis by changing one variable at a time and including an unchanged variable terrted a n O experimental variable O altered variable O control

4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3

In eukaryotes translation takes place O on the plasma membrane O inside the nucleus Oon ribosomes O on the nuclear membrane on spliceosomes QUESTION 36 Ribosomes are complex aggregates of ORNA and DNA O RNA and proteins ORNA and sugars O DNA and proteins O nucleosomes and RNA

In eukaryotic cells transcription occurs on the surface of the nuclear membrane on ribosomes on spliceosomes inside the nucleus on the surface of the plasma membrane QUESTION 38 During replication sequencing transcription translocation translation nucleotide sequence information is changed into amino acid sequence informat

QUESTION 29 The connection that exists between genes and hereditary traits is based on using the information encoded in genes to synthesize O codons O nucleotides O proteins O histones O complementary bases QUESTION 30 The one gene one enzyme hypothesis was proposed by O Watson and Crick O Griffith Garrod O Franklin Beadle and Tatum

During DNA replication which enzyme removes the RNA primers and then fills in the gap O DNA pol I O DNA primase O DNA pol III O DNA ligase QUESTION 20 I think the proactive stance is a better attitude to promote than after the fact worrying When planning a long week of sunbathing on the beach what type of DNA damage should sunbathers be aware of before hitting the beach O photolyase induced mutations O decreased telomere length O thymine dimers activation of uvr A B and C genes

If 14 of the nucleotides from a DNA molecule contain the base T what percent will contain the base G 14 18 28 36 O 72 QUESTION 12 If a short sequence of DNA is 5 AATTGCCGT 3 its complement is O 5 AAAACGCCA 3 3 TTAACGGCT 5 3 TTAACGGCA 5 3 TTAAGCCGA 5 O 5 TTAACGGCA 3

Eukaryotic organisms speed up the process of DNA replication by O shortening the initiation phase O producing several sliding clamp complexes which provide more binding sites for DNA pol III O using DNA gyrase to unravel the double helix rather than DNA helicase O using multiple origins of replication on each chromosome QUESTION 16 Endonucleases and exonucleases are enzymes that can remove nucleotides from a polynucleotide chain An endonuclease removes nucleotides while an exonuclease removes nucleotides from the 5 end of the chain from the 3 end of the chain from the 3 end of the chain from the 5 end of the chain O internally from the ends of the chain O from the ends of the chain internally

A scientist specializing in the study of plants is a n botanist True O False

What is the average radius of a piece of double stranded DNA in water that has a link length of 5 8 nm and and is 2237945 links long Submit Answer Tries 0 99 of the two strands of the double stranded DNA are separated each chain now has a radius of 1163 nm What is the link length for single stranded DNA Submit Answer Tries 0 99

ons must be lost or gained by each of the following atoms to attain a noble gas electron configuration Be sure to indicate whether they are lost or gained a Ca d P b Al e Na c S f Cl What charge would each element obtain when it becomes an ion a aluminum e lodine b lithium f phosphorus c barium g sulfur d bromine h magnesium

1 What are valence electrons Why are they so important in chemistry 2 Write the electron dot structures for the following elements a Cl b S c Al d K 3 What is the octet rule e Ca f Ge

Which of the following statements are correct with respect to protein synthesis Check all that apply View Available Hint s Protein synthesis always starts with an initiation codon The protein chain always stops with valine Uracil is one of the bases present in a DNA strand Many amino acids can be synthesized using one of two different codons If the codon AUG does not appear at the 5 end of mRNA it codes for the amino acid methionine A stop codon is not required to stop protein synthesis Submit Previous Answers X Incorrect Try Again One attempt remaining

Experimental studies on humans are conducted as double blind studies What does this mean O The subject and scientist are unaware of who receives the placebo O The subject and scientist are aware of what the experiment is about O Both the subject and the scientist are aware of who receives the placebo ntc

Organize the following sentences according to Koch s postulates 1 2 3 4 A The pathogen must be isolated from the new host and must be identical to the initial pathogen Number Select B The suspected pathogen can be isolated and purified Number Select C The suspected pathogen must be found in every case of sick patients and be absent from healthy individuals Number Select D The healthy individual that received the pathogen must develop the same signs and symptoms as the initial infection Number Select