Biotechnology: Principles and Processes Questions and Answers

government Rule of law Magna Carta Petition of Rights and English Bill of Rights

2 How would you describe a plate that had several cultures growing on the plate A

Cystic fibrosis is a disease that affects the ability of cells to move sodium across the cell membrane This causes mucus to build up in the lungs resulting in respiratory problems 11 What is the inheritance pattern shown 12 Provide at least one piece of evidence for your claim OT T 6000 58

a Describes a particular species Ob Directs the user to one of two species identifications O c Is always the same as a branch on a phylogenetic tree Od Describes a particular genus Oe Directs the user to one of two choices which can be either identifications or other coupl

specimen a Illuminator b Condenser c Ocular lens compound microscope helps to focus light d Coarse focusing knob 5 Search DEGHO OMBN M O en O

What characteristics led to Ancient Greece being relatively disease free Select all choices that may apply X The Greek gods blessed the culture Selected Answer Incorrect Isolated nature of the city states Increased trade between the city states

Refer to the Tests tab Which test will most quickly and reliably help you identify the pathogen Blood test for antibodies Blood cultures Viral or bacterial cultures Ranid PCR

22 Which statement is correct for Ca H pump Ca and Hiones are transported against the concentration gradient This enzyme uses metabolic energy to transport pump 2Ca outward and 2H inward Ca H pump is electrogenic antiporter b Cal and Hiones are transported down the concentration gradient This enzyme uses metabolic energy to transport pump 1H outward and 2 Ca inward Ca and Hiones are transported against the concentration gradient This enzyme uses metabolic energy to transport pump 2H outward and 2Ca inward Ca H pump is symporter HandCa iones are transported against the concentration gradient This enzyme uses metabolic energy to transport pump 1H outward and 3Ca inward CalH pump is non electrogenicantiporter a c d 23 V V ATP ases V type pumps transport a H ions down their concentration gradient using energy of ATP hydrolysis b H or Na ions against their concentration gradient using gradient energy c H and Na ions antyporter against their concentration gradient using energy of ATP hydrolysis d H ions against their concentration gradient using energy of ATP hydrolysis

American Write a proposal that discusses your minority group In it include 1 A 250 word essay that discusses o The group you selected and why you selected it o What you are most excited to learn o Three pieces of applicable dat you found in your research 2 An APA formatted reference page 7th edition that includes your four sources You may change your sources or add to

Theories are supported by more evidence than hypotheses True or False True False

1 Translational decoding and peptidyl transfer are bridged by A termination codon B EF G hydrolysis of GTP C EF Tu hydrolysis of GTP D tRNA aminoacylation E initiation

E decoding errors an 6 The protein complex that bridges between the enhancer and the core promoter is the A mediator B negotiator C transposase D DNA polymerase III E translocase

are enzymes that cut DNA molecules at specific DNA sequences

O True O False Question 68 1 pts Pangea was a supercontinent that formed around 500 mya million years ago and broke up around 300 mya True

2 The editors at Science and Nature decided not to publish the paper How should academic journals deal with potentially controversial research What are their moral and social responsibilities

What are the differences between a lytic and a lysogenic infection?

For this question on genetically modified organisms, please pick ONLY ONE of the following questions to answer. I.e., you have a choice of which you would prefer to answer, so pick the one you're more comfortable with. Please do not answer them all as I will only grade the first (and hopefully only!) one you answer! Option #1: Pick a type of organism (e.g., bacteria, plant, etc.) and describe steps that would be involved in making it a genetically modified organism.

You want to insert a gene into a plasmid in order to transform E. coli and give it new capabilities. You have both the gene and the plasmid available. In order to put the gene into the plasmid, you would first need to treat both with the same. restriction enzyme DNA polymerase RNA polymerase ligase

Which one of the following PCR components is present in qPCR but not in conventional PCR? Taq DNA polymerase DNA primers Nucleotides (A, T, G, and C) MgCl2 (cofactor) A fluorescent probe

During the annealing step.... Primers bind to the newly separated DNA strand The two DNA strands separate at high temperature The Taq DNA polymerase forms a complex with DNA and histones The new DNA product is run on an agarose gel

What is the role of the Taq DNA Polymerase? Causes the DNA strands to separate Frames the beginning and end of DNA to be copied Copies the DNA Transcribes DNA into mRNA Reverse transcribe mRNA into cDNA

Nucleotide triphosphate (dNTPs) are added to the growing DNA strand during the _______ phase Annealing Extension/elongation Denaturation/separation Preparation

What would show where within a tissue a gene's mRNA was expressed? immunohistochemistry. immunocytochemistry. bacterial transformation. RNA in situ hybridization.

According to the AMA, using an electronic claim instead of paper can provide a savings of as much as ______ in processing costs per claim. 3.73 2.9 6.63 0.6

"DNA fingerprinting" uses RFLPs and gel electrophoresis in order to map the genetic differences between two individuals based upon (A) residue left from their fingerprints at a crime scene. (B) slight differences in the lengths of pieces of their DNA after restriction enzyme digestion. (C) single-nucleotide differences within genes for similar traits. (D) differential gene expression within the cells of the two individuals. (E) the existence of tissue-specific promoter sequences within short segments of their DNA.

You are a baker with your own unique strain of baker's yeast species Saccharomyces cerevisiae. From a single colony of your yeast, you isolate genomic DNA and amplify the 18S ribosomal RNA gene by PCR. (The 18S gene is the eukaryotic equivalent of the prokaryotic 165 gene.) When you run the PCR products in an agarose gel, you find a single band of DNA. You observe a single band of DNA because: The PCR products have different DNA sequence but are all the same size The PCR products are different sizes but have the same DNA sequence The PCR products have the same DNA sequence and are all the same size The PCR products are different sizes and have different DNA sequences

3. You add an appropriate amount of an antibiotic to a turbid broth culture of bacteria, and within a few minutes the culture visibly clears. a) Can you tell the mechanism of action from these results? b) If so, what is it? c) If not, what tool would you need to figure it out?

Each of the following are features of a cloning vector except Select one: a. origin of replication. b. reverse transcriptases. c. genetic markers used to screen for recombinants. d. capacity for large inserts. e. multiple cloning sites.

If your sample looks too opaque, what adjustment should be made? Adjust the course focus. Adjust the fine focus. Increase the light coming through the diaphragm. Decrease the light coming through the diaphragm.

Why do we draw our specimens in a circle when using a microscope? It indicates the viewing field as viewed through the eyepiece. Squares are boring. The objective lenses are round. Ohe adjustment knobs are round.

For control of microbial life, which of the following are included as actions on the microbes to destroy them? breakdown or cause problems with the cell membrane cause breakage in the DNA cause proteins and enzymes to denature (lose shape) two of these A, B and C of the above

The role of isopropanol or ethanol in plasmid DNA precipitation is: 1. Isopropanol/ethanol makes plasmid DNA more soluble in aqueous solution 2. Isopropanol/ethanol makes genomic DNA more soluble while it makes the plasmid DNA less soluble, so plasmid DNA is precipiated 3. Isopropanol/ethanol makes plasmid DNA less hydrophilic (less soluble) in the presence of high salt concentration, so plasmid DNA falls out of the solution 4. Isopropanol/ethanol links DNA to proteins so that the DNA-protein complex precipitates

Polymerase chain reaction requires a DNA polymerase from a bacterium that lives in hot springs. Tagl telomerase T7 DNA polymerase Pol III

During the process of DNA replication all the following will occur except: the molecule unzips the molecule adds complementary bases to the original strand the molecule unwinds. extra phosphates are added.

9. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would you see on the electrophoresis gel? BamI (CCT'AGG) --- 5' CCTAG ¥G 3'; EcoRI (GAATTC) --- 5' GAATTC 3' 3' 5' ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3'TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5'

Engineers are often tasked with building structures in places where grasslands and trees once grew. What might be some practical things to include in their building plans to minimize the amount of albedo change that area might experience?

Students set up a controlled experiment. They put five crickets in each of three identical containers. They set one container to 15°C, one to 20°C, and one to 25°C. Then they count the number of cricket chirps in each container during 1 hour. What are two constants in this experiment? A. The temperature of each container B. The number of crickets in each container C. The kind of containers used D. The number of cricket chirps

If a horticulturist breeding gardenias succeeds in having a single plant with a particularly desirable set of traits, which of the following would be her most probable and efficient route to establishing a line of such plants? a) Force the plant to self-pollinate to obtain an identical one. b) Backtrack through her previous experiments to obtain another plant with the same traits. c) Clone the plant. d) Breed this plant with another plant with much weaker traits.

Which THREE statements are true about targetting proteins to the nucleus? A) The nuclear localization sequence is emoved after targetting to the nucleus? B) The nuclear localization sequence is ocated almost anywhere in protein amino acid sequence. C) The nuclear localization sequence contains several consecutive basic (Arg or Lys) residues. D) Aln the cytoplasm, a protein with an appropriate nuclear localization signal (NLS) is bound by a complex of importin ⍺ and ⍴. E) Importins a and B and CAS are degraded in the nucleus. F) The nuclear localization sequence usually contains around 20 amino acids.

What stages are involved in the development of a hybrid cultivar? What are three different type of hybrid crosses? What are some advantages and disadvantages of these different types of crosses?

What is not an important requirement for an ideal bone tissue engineering scaffold? A) ceramic-scale stiffnesses. B) None. These are all important. C) bioactivity. D) interconnectivity. E) architecture. F) biocompatibility.

ECOR1 cuts Plasmid T into 3 pieces. Feeling grumpy at your professor (), you decide to take a random enzyme and mix it with a random plasmid, Plasmid M (for mystery). You run a gel and see one very large band at the top of the gel. Which of the following is NOT likely: a. Plasmid M has zero restriction sites for any enzyme b. The enzyme and plasmid are not the same as Ecor1 and Plasmid T c. Plasmid M wasn't cut at all d. The plasmid does not have a restriction site for the mystery enzyme

What is balanced pathogenicity? What happens to the interaction between the host and the virus?

Polymerase Chain Reaction is a method used to separate DNA fragment by size. s a laboratory technique used to make numerous copies of a segment of DNA is a repeated nucleotide sequence in DNA at a specific location on a chromosome is a single nucleotide different in DNA at a specific location on a chromosome

In steps 7-10 of the Lab 2 protocol, why does adding SDS, then ádding potassium acetate, followed by centrifugation, precipitate the proteins and chromosomal DNA out of solution? Why does the RNA not precipitate out? (4 marks)

The term "true-breeding strain or true-breeding-line" is best described by which of the following statements about pea plants? A pea plant that when crossed with another pea plant produces the same trait each generation A pea plant that when allowed to self-fertilize produces several different traits in each generation A pea plant that when crossed with another pea plant produces different traits in each generation A pea plant that when allowed to self-fertilize produces the same trait each generation

4. A lab report on a patient with a staphylococcus infection has come back showing that staph has a Kirby-Bauer result of 31 mm for ampicillin. Why must the physician take each of the following items into consideration when deciding whether or not to prescribe ampicillin? a. Kirby-Bauer results b. Patient history c. Staph resistance data (use the Antibiotic Zone of Inhibition Table) d. MIC

Gizmo Warm-up Many farmers use chemical herbicides to kill weeds and insecticides to kill insects. Using genetic engineering, scientists have developed ways to resist harmful crop pests. In the Genetic Engineering Gizmo, you will use genetic engineering techniques to create genetically modified corn. Check that Task 1 is selected. The Gizmo shows petri dishes that contain different strains of bacteria (white dots) and caterpillars (Lepidoptera sp. larvae). In the first challenge, your goal is to find bacteria that produce toxins that kill the caterpillars. Click Play 1. What do you observe? 2. 3. Which strains of bacteria were able to kill Lepidoptera sp. larvae? 4 Were some more effective than others? Explain.

Which of the following regarding proteomics is FALSE? a. Proteomic studies rely upon studying one protein at a time, and use this protein as a model for other proteins. b. Proteomic studies often involve analysis of post-translational modification, abundance, and/or turnover of proteins. c. Mass spectrometry has been important in proteomic studies. d. Proteomic studies are often technically more difficult than genomic studies because proteins have more variation in their biochemical properties than nucleic acids do.

The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is shown as red while DNA is black. What will happen next? (Hint: Recall the order in which you used enzymes in the DNA replication simulation in Section 2.) Ligase will seal the nick in the bottom strand. DNA polymerase I will replace the primer with DNA. Helicase will separate the strands. DNA polymerase III will extend the primer.