Biotechnology: Principles and Processes Questions and Answers
Biology
Biotechnology: Principles and ProcessesThink About It Task Use the listed words to complete this paragraph about ho One trait that demonstrates the some finches being better suited to their suited to the variation of Fo in the drier environment In the very we
Biology
Biotechnology: Principles and ProcessesSelect the statement s that correctly describe s the role of p21 Which if the following correctly describes the role of p21 p21 is produced in response to increasing levels of Rb p21 levels increase as levels of oncogenes increase p53 triggers the production of p21 which regulates Cdk activity p21 regulates the fluctuations seen in the cyclins in the cell cycle
Biology
Biotechnology: Principles and ProcessesSelect the statement that incorrectly describes p53 The tumor suppressor protein p53 detects DNA damage prior to the mitotic phase of the cell cycle Defective p53 cannot trigger apoptosis Mutated p53 may cause cells with DNA damage to continue to divide Normal p53 will stop the cell cycle when DNA damage is detected Mutated p53 may cause cells to become cancerous
Biology
Biotechnology: Principles and ProcessesSelect the statements that correctly describe retinoblastoma and p21 Rb reinforces the effect of p53 by binding to Cdk cyclin complexes 0 As levels of p53 increase the production of p21 is triggered The combined effect of p53 and p21 prevent the cell from entering the S phase of interphase Rb is active when it is dephosphorylated and bound to transcription factors Rb is activated when the cell is at a very small size Rb and p21 are examples of positive controls of the cell cycle
Biology
Biotechnology: Principles and ProcessesThink back to question 4 on Lecture 11 Part 1 Assignment What type of PCR could you do on your culture after exposing it to an antibiotic for a period of time to quantitate the levels of expression for a certain gene which you identified as encoding a protein product that helps clear that antibiotic out of the cell in your molecular cloning library construction experiments
Biology
Biotechnology: Principles and Processescourses SC BIOL1000 N Biology I Ce In Polymerase Chain Reaction one of
Biology
Biotechnology: Principles and Processes6 As you know experiments include controls In this lab a negative control was included along with your experimental samples Which components do you think the negative control would contain Hint Think about which component would be left out of the negative control relative to the experimental samples Explain why
Biology
Biotechnology: Principles and ProcessesDrag each tile to the correct box Arrange the sentences in order to describe how oxygen from air is transported to the cells in the kidneys
Biology
Biotechnology: Principles and ProcessesWhich of the following is NOT an example of the national government s obligations to the states O Protection from foreign invaders Recognition of state boundaries O Insurance of economic stability Protection from domestic violence Complete Later Complete S
Biology
Biotechnology: Principles and ProcessesThink about the Article It s All Online How are the Yahoo security breach and the Target security breach the same A Both security breaches took place in 2017 B both hackers stole information about people C Credit card information was stolen in both breaches D In both three billion e mail accounts were hacked
Biology
Biotechnology: Principles and Processes14 Three genes m n and o not necessarily in that order are located on the same chromosome The genes m and n are 22 map units apart n and o are 28 map units apart and m and o are separated by 6 map units The probability of a double crossover occurring in the two regions marked by these genes is a 0 0132 b 0 28 c 0 0013 d 0 06 e 0 22 15 Consider the following asci from Neurospora What is the map distance between the gene for white ascospores and the centromere a 16 cM b 0 08 cM c 8 cM d 0 16 cM e none of the above DO 395 31 70 445 Total 1000
Biology
Biotechnology: Principles and Processes10 Tetras are popular tropical fish to raise and breed as a hobby A tetra breeder has a set of dihyb females that have blue eyes and long tail fins She uses these to do a testcross to males that are homozygous for the recessive alleles for black eyes b b and short tail fins tt The following numbers of each type were born 321 with blue eyes and short tail fins 44 with blue eyes and long tail fins 376 with black eyes and long tail fins and 52 with black eyes and short tail fins From these data the breeder can deduce that in the dihybrid parent the alleles are a linked in Cis b linked in Trans c not linked 11 The lengths of chromosomes differ from one species to another In one the longest chromosome is 294 map units long while the shortest is 102 map units in length a True b False This means that alleles at the tips of each chromosome in this species essentially show independent assortment
Biology
Biotechnology: Principles and ProcessesAccording to EPA guidelines solid waste LEGALLY can be found in all of the following states of matter EXCEPT
Biology
Biotechnology: Principles and ProcessesColonization refers to host invasion of pathogenic microorganisms the presence of bacteria in the blood the replication of bacteria in the blood establishment of a microorganism in a host without effects of diseas the presence of viruses on the skin and mucus membranes
Biology
Biotechnology: Principles and ProcessesForm Organize Convert Share Review Accessibility Typewriter Sticky Note 5 22 T Highlight Bookmarks Help Web Links
Biology
Biotechnology: Principles and ProcessesWhich of the following does not pertain to helminths Have various organ systems O Often alternate hosts in complex life cycles O Eggs and sperm used for reproduction O In kingdom Protista O Parasitic worms
Biology
Biotechnology: Principles and Processes2 1 point A parent with Type AB blood has a child with a parent who has Type B blood First give the genotypes that are associated with each phenotype Use the following alleles IA IB and i Phenotype A Type Blood B Type Blood AB Type Blood O Type Blood Genotypes A parent with Type AB blood has a child with a parent who has Type B blood
Biology
Biotechnology: Principles and ProcessesWhich of the following forms microsomes during differential centrifugation Rough ER Smooth ER Golgi Complex All of the above
Biology
Biotechnology: Principles and ProcessesIn plant cells chloroplasts Serve the same purpose as mitochondria do in animal cells Are the site of conversion of light energy into chemical energy O Play an important role in the breakdown of plant toxins Generate turgor pressure A and B are correct QUESTION 5 Certain eukaryotic cells have motility most closely associated with which structure endoplasmic reticulum O Golgi apparatus O cytoskeleton Ochloroplast
Biology
Biotechnology: Principles and ProcessesDmitri Ivanovski demonstrated that TMV was not spread via bacteria by 1 sterilizing sap from an infected plant and then applying it to a healthy plant 2 transmitting sap of infected plants from generation to generation 3 spraying sap from an infected plant onto a healthy plant 4 treating an infected plant with a broad spectrum of antibiotics before extracting sap O5 filtering sap from an infected plant through pores smaller than bacteria and then applying it to a healthy plant
Biology
Biotechnology: Principles and ProcessesFor a protein assay absorbance is measured at what wavelength of light O 670 nm O 405 nm 595 nm 280 nm
Biology
Biotechnology: Principles and ProcessesQuestion 1 20 points The following sequence corresponds to the DNA co Mutant I corresponds to a transition silent mutation ATGACGGATCAGCCTCAATACGAAT
Biology
Biotechnology: Principles and ProcessesPROBLEM V The following strand is on the template strand of a hypothetical gene TCGCTGCATGGCTTCAGCCTCGTATCATTACCGACATATGTC 1 How many possible open reading frames can you see on the coding strand of this gene 2 Find the protein product of the first open reading frame of the coding strand Hint the reading frame produces a longer polypeptide rg Arg
Biology
Biotechnology: Principles and ProcessesRNase is an enzyme that cleaves the P 05 bond in RNA It has two His residues in the active site Suggest a plausible explanation why the enzyme activity changes when pH is increased or decreased from pH 6 0 as shown in the graph Activity 120 100 80 60 40 20 0 10 pH Data provided by Dr Sunita Chowrira University of British Columbia Choose all of the true statements Both His residues are deprotonated at pH higher than than 6 5 The substrate is affected by the change in pH and is inactive postively charged when pH is above 6 0 The RNase reaction is an example of metal ion catalysis with a positively charged metal There are two His residues and both are deprotonated below pH 4 2 RNAse is an acid base catalyst
Biology
Biotechnology: Principles and ProcessesTime min Actual A Initial Reading I 2 4 6 8 10 12 14 16 18 Respirometer 1 Tube 1 CO 20 Evolved A I Respirometer 2 Tube 2 Actual A CO Evolved A I Respirometer 3 Tube 3 Actual A CO Evolved A I Respirometer 4 Tube 4 Actual A CO Evolved A I
Biology
Biotechnology: Principles and ProcessesIn cell extracts are separated on the basis of size and shape using a sucrose gradient Velocity sedimentation shallow Equilibrium sedimentation steep O Equilibrium sedimentation shallow O Velocity sedimentation steep O Equilibrium sedimentation shallow
Biology
Biotechnology: Principles and ProcessesMutated DNA sequence TACCCACTTGCGTGCATC mRNA sequence Amino acid sequence AUGGGUGA ACGCACGUAG Met GIY Glu Arg Thri Stop What type of mutation is this 2 What is the result of this mutation
Biology
Biotechnology: Principles and Processes4 Consider a family in which there are five children all of them boys The mother is pregnant What is the probability that the sixth child will be a boy Write the answer on the back of the scantron sheet 5 A chromosome with a centromere nearer one end than the other has one short arm and one long
Biology
Biotechnology: Principles and Processes18 The probability that their first offspring has the genotype G G M m d d Ss JJ Bb is x Gg MM Dd ss Jj Bb mate a 1 128 b 1 12 c 1 64 d 1 32 e none of the above 6 6 mm Dd Ss ji Bb Refer to the following Cross Female x Gg MM Dd ss
Biology
Biotechnology: Principles and ProcessesWhich of the below is a reason for the paucity i e lack of specific studies looking into the effects of hormones taken during egg harvesting procedures on young fertile egg donors Artificial egg extraction is only a decade old so there hasn t been enough time to collect long term data The risk of breast cancer for those who take hormonal drugs for IVF at a young age increases by more than 50 after 16 years The effects of these same hormones used on infertile women are well studied and can be generalized to fertile women No answers are correct Doctors or would be parents don t want to consider that they may be agents within a cancer causing industry
Biology
Biotechnology: Principles and ProcessesMicroscope Micrograph Binocular microscope Magnification Resolving power Oil immersion lens Scanning electron microscope smission electron microscope A microscope with two ocular lenses An instrument that magnifies an object A lens that can magnify objects up to 1000X Photograph of microscopic images Magnifies an object s surface Magnifies internal cellular components The ability of a microscope to distinguish two adjace structures as separate Enlargement of an object
Biology
Biotechnology: Principles and Processes2 Note the color of the reaction in each tube at each observation time point 3 Time O 15 minutes Day 2 Tube 1 NO COLDY No Calor Tube 2 yellow Green yellow Bellow green Transcription orange Table 3 What processes occured Based on the colors you observed state whether or not you think transcription and or translation happened in each of the tubes 1 4 Then explain whether this conclusion agrees with your initial predictions If it does not can you think of a reason that it may not Tube 3 Translation Tube 4 N CN Color Yellow Yellow stoon breen Fellow vellow green green erange Do your conclusions match your predictions from Table 12
Biology
Biotechnology: Principles and Processes6 What is a stem cell 7 Though the original chimera was found in Greek mythology what is an example a chimera in the world of genetic engineering 8 How to retroviruses replicate 9 What is gene therapy thorany not widely successful
Biology
Biotechnology: Principles and Processesexplain how neurotoxins can disrupt neurotransmit release
Biology
Biotechnology: Principles and ProcessesHow many nuclear reactors are being operated around the world O 268 O 452 O 321 O 1004
Biology
Biotechnology: Principles and ProcessesIdentify the greenhouse gas O Neon O Nitrogen O Methane O Oxygen
Biology
Biotechnology: Principles and ProcessesWhich among the following is an example of a chemical reaction A silver spoon tarnishes O An iron bar rusts O An antacid relieves heartburn All of the choices
Biology
Biotechnology: Principles and ProcessesDuring World War II the Bosnians had sided with the O French O British O Germans O Russians
Biology
Biotechnology: Principles and Processes16 AKS 8a3 A plasmid is A a small circular piece of DNA that is part of the chromosome B a small circular piece of RNA that is non chromosomal C a small circular piece of non chromosomal RNA normally found in bacterial cells D a small circular piece of non chromosomal DNA normally found in bacterial cell
Biology
Biotechnology: Principles and Processes15 AKS 8a Recall that hemophilia is a blood disorder in which an individual cannot produce a clotting protein and as a result experiences excessive bleeding when injured Which of the following questions wo BEST guide a scientist researching potential gene therapy for hemophilia A Will injecting clotting protein directly into a patient s blood cure hemophilia B Will producing a vaccine to administer to a hemophiliac patient cure hemophilia C Will replicating copying the dysfunctional copy of the patient s clotting protein cure hemophili D Will inserting a normally functioning copy of clotting protein gene in a patient s blood cells cure hemophilia
Biology
Biotechnology: Principles and Processesstain used to color the background bacteria will not be stained stain used to color bacteria background will not be stained 1 positive stain 2 negative stain 3 simple stain 4 smear stain
Biology
Biotechnology: Principles and ProcessesUse Figure 1 to answer questions 3 and 4 C Step 2 Figure 1 DNA of Mum ITA Step 1 0 3 AKS 8a3 Which of the following best describes what is occurring in Step 1 of Figure 1 A Step 1 involves the bacterial plasmid and the gene of interest being cut with different restriction suk nye prorocjo3 enzymes B Step 1 involves the inclusion insertion of the gene of interest within the bacterial plasmid C Step 1 involves both the bacterial plasmid and the gene of interest being cut with the same restr enzyme on 1 inyolyes the inclusion insertion of the bacterial plasmid with the gene of interest
Biology
Biotechnology: Principles and Processeson to gr and paying attentio spenning Reflect on the history and celebration of Juneteenth by
Biology
Biotechnology: Principles and ProcessesO ionic bonds only O single and double bonds single bonds only O double bonds only Question 16 Isotopes of an element will always differ in O reactivity O atomic number O atomic mass O number of protons O number of electrons 2 F
Biology
Biotechnology: Principles and ProcessesUnripe fruits are hard and tart Ripening is a process that sweetens and softens the fruit to make it more attractive to animals who will eat the fruit and disperse the seeds A plant hormone ethylene leads to the ripening of many fruits Once ethylene starts being pro duced it initiates a feedback loop that causes more ethylene to be produced increasing the rate of ripening Which of the following best identifies and describes the feedback loop initiated by the pro duction of ethylene A B It is a positive feedback loop because the initiating stimulus causes a subsequent in crease in the stimulus D It is a negative feedback loop because the initiating stimulus causes a subsequent in crease in the stimulus C It is a positive feedback loop because the initiating stimulus causes a subsequent de crease in the stimulus It is a negative feedback loop because the initiating stimulus causes a subsequent de crease in the stimulus
Biology
Biotechnology: Principles and ProcessesTable 6 Year Jan Feb Mar Apr May Jun Jul 2012 20 30 43 10 5 12 15 2013 30 45 35 20 30 20 5 2014 60 18 8 15 10 27 30 42 What is the independent variable 43 What is the dependent variable 44 What type of graph will you use Aug 25 7 35 Sep Oct 10 15 10 40 45 Plot your graph below don t forget to label axes and title 30 45 Nov 28 50 50 Dec 50 10 60