Ecology - Biodiversity & Conservation Questions and Answers

In order to reuse an enzyme after the conclusion of an enzyme catalyzed reaction what must occur O the enzyme has to be resynthesized O the enzyme has to separate itself from the product O changes into an active form O the enzyme has to decrease entropy QUESTION 8 You are studying an enzyme catalyzed reaction that induces a particular cellular activity in the lab If you wanted to slow down that particular cellular activity by controlling the enzyme what could you do O Decrease the temperature of the incubator where the cells are growing O Increase the pH of the media the cells are growing in to the optimum pH O Add cofactors to the media the cells are growing in O Add an allosteric activator to the cells QUESTION 9

Each of the following is fermentation products except acetyl CoA lactate propionate OO ethanol Question 10 0 5 points Listen Why are mitochondria so prevalent in skeletal muscle Mitochondria provide the muscle elasticity to contract More mitochondria are required in tissues where blood flow is restricted Mitochondria provide energy for muscle contraction

Owas isolated from an ancient meoterite sample found in Australia is a virus that infects other viruses O is the first virus found to replicate outside of a host cell O is hypothesized to be the ancestor to all other viruses Question 4 Icosahedral capsids are only found in Giant viruses because the complexity of the capsid requires a minimum of 80 genes to constru O True False Question 5 The coccolithovirus can cause algal blooms by infecting and ultimately killing the primary competitors of marine algae

You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall

5 Which of the following are unlikely to grow on Simmons citrate agar Select all that apply a E coli b S flexneri c A bacterium that requires an inorganic nitrogen source d A bacterium that lacks citrate permease e E aerogenes 21

31 Which of the following is a inverse PCR method A using primers with 1 bp change to generate mutations no B using primers with restriction enzyme sequences adapter on the 5 end using primers that sequence outwards to obtain upstream and downstream sequence none of the above D

PREDICTION 0 Atmosphere no 02 more CO2 Earliest 2 1 F Atmosphere more 02 less COZI ON B Haceral Cell Prokaryote Multicellutar Plant Energy Competition Chemoautotrophie Anaerobic Bacteria 3 Multicellular Animal Ocean of Molecules 12 AHME RNA 4 A 5 H C Cyanobacteria M sen 6 7 D GD H 1 Organic molecules N Prediction Provide a justification for your group s sequence of events HISTORY OF LIFE ON EARTH 8 H L E Unicellular Eukaryote 9 J Big Bang How did you know which cards to place first S the beginning BID bang What is the reason you placed the cards on the latest end Bis the latest beca 10 I 11 up you will first make a prediction about the sequence of events by placing the environment and organism cards along the timeline poster provided by the teacher Place earlier events on the left hand side of the timeline and later events on the right hand side Provide a justification for your choices in the space below 3 12 13 JE of the anivers e 14 Latest 15 F 3 Animal is Latest new to the world ar Which cards are you most uncertain about their placement everything comes First then s What questions do you now have

Was the Columbian Exchange

DNA Replication Labeling with word bank DNA polymerase 5 DNA Ligase Okazaki fragment DNA Primase Single Strand Binding Leading Strand Lagging Proteins Strand 5 3 Helicase RNA primer OTTY Mys Ox 3 5 Topoisomerase

Cellular respiratio Oxygen in CO Oxidative phosphorylation trix Inner mitochondrial membrane Matrix Recreate the order of the flow of electrons through oxidative phosphorylation from the electron donor to the terminal acceptor Start by clicking the first item in the sequence or dragging it here Drag the items below into the box above in the correct order starting with the first item in the sequence Electrons are donated to oxygen Protein complexes accept electrons and also pump protons across the mitochondrial membrane

11 Anyone that is at least sixteen years old that is employed or that is actively looking for a job A person that has given up looking for a job Is when people change jobs or looking for their first 12 13 job 14 The percentage of people that are in the labor force who want to work but can t find a job 15 When people become unemployed because they lack certain skills or education The supply and demand of jobs in the economy 16

Which of the following is NOT one of the 4 basic elements of all living things Hydrogen Oxygen Carbon Potassium Question 9 1 point

https commons wikimedia org wiki File TransOceanus TedicuitC CE gr2 png a Toda Macrobia century trade and communications made this an early example of which of the following choices Choose the BEST answer increased O A trade route O Global integration Transportation of goods and services

A sponge has the following only cells no tissues Ono gut cavity a blastocoel a coelom Da blastopore is formed during development Question 41 1 point Listen Arthropods have metameres and a bilateral body symmetry O True False

altitude it is covered with snow What is the central idea of this paragraph O Everest is always covered with snow Mount Everest is the highest peak in the world The altitude of Mount Everest is not significant Mount Everest can be measured

Which figure of speech is used in the phrase Cute as a bug Metaphor O Simile O Personification Hyperbole

Identify the figure of speech used in the expression He is a tiger in the boxing ring O Idiom O Metaphor O Hyperbole

What is onomatopoeia It is the representation of a place event literary work myth or work of art either directly or by implication It is an expression peculiar to a particular language that means something different from the literal meaning of the words It refers to words that imitate the sound they denote It is the fallacy of attributing inanimate O human feelings to

What does a cakewalk mean in the sentence below Last year the match was a cakewalk for her but this year I believe there is stiff competition O Easy O Tough O Walking cake

volume of forgotten lore While I nodded nearly napping suddenly there came a tapping As of some one gently rapping rapping at my chamber door Tis some visitor I muttered tapping at my chamber door more Only this and nothing Find the figure of speech used in the lines above O Personification O Metaphor O Alliteration

Select all that apply Choose all general assumptions made by scientists The universe s fundamental properties have not changed since its inceptio All natural forces acting now have always acted The fundamental nature of the Universe is in constant flux The Universe can never be completely described 1 1 O

Choose the correct answer In Greek dramas the role of the O protagonist O antagonist O confidant O None of the choices was awarded to the best actor

Which of the following is NOT a belief of Transcendentalists O Everything in the world is a reflection of the divine soul O Intuition gives one an understanding of right and wrong O Having personal belongings is more important than having other things O The natural world is a doorway to the spiritual world

Question 64 Choose the correct answer to complete the statement A simile is Points 1 O an exaggeration or overstatement O a comparison of two unlike things a statement with restraint to emphasize what is being talked about O a term for an often repeated idea or theme in literature

Why is this a bad example of the visual strategy Mutualism is a biological interaction between two species wherein both the species benefit from each other O The definition is incorrect The picture is not unexpected or funny so you won t really remember it The image came from google

Why do you think the title of Achebe s novel is Things Fall Apart The novel describes the end of harvest season The novel describes the O breakdown of a man and his society The novel describes a natural disaster All of the choices

What was the purpose of the passage of the Title IX Act Ensure that there is no discrimination in women s collegiate athletes O Avoid discrimination is based on race on college campuses O Avoid discrimination based on age of collegiate O Avoid discrimination based on class

People also ask What is the importance of gender equity

What was the hardest part of the experience for poor immigrants crossing the Atlantic Ocean O Traveling in steerage O Being homesick Being forced to do hard labor O Leaving their families in their home countries Questic 1 5 9 13 17 21

Question 3 Points 1 Also known as the Unequal Treaties this protocol was signed with China after the failure of the Boxer Rebellion Chinese Protocol Boxer Protocol Eastern Protocol O Unequal Protocol Complete Later Complete Reset Reset butte this assess Reset Questions 9

The repuration daytoy were hoch They were The Gruppe were are that the army was bases d OUS e disband may forever 6

Question 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The speciation of squirrel populations separated by a geographic barrier C The extinction of a species of eucalyptus tree due to forest fires D Slow changes to a habitat that cause divergence in forest populations SUBMIT

Match the tissue type with its function protection from wear and tear supports and binds other tissues can act as a water reservoir filtration and exchange of substances via diffusion absorption and secretion withstand high tension and stretching particularly in one direction 1 Simple squamous epithelium 2 Simple columnar epithelium 3 Stratified squamous epithelium 4 Dense regular connective tissue 5 Areolar connective tissue

dentify what humans can do to minimize the impact of urban sprawl on wildlife

18 Which of the following environmental features might influence microclin O forest canopy Ofreshly plowed field log on the forest floor Olarge boulder of the options are correct

tollowing terms with their descriptions The smaller branch of a spinal nerve that innervates the posterior body trunk The connection between the spinal cord and a spinal nerve containing sensory fibers The connection between the spinal cord and a spinal nerve containing motor fibers The larger branch of a spinal nerve that innervates the anterior and lateral trunk and limbs 1 Dorsal rami 2 Dorsal roots 3 Ventral rami 4 Ventral roots

24 Why are drinking water supplies still a major concern for many countries

Patterns in biogeography have revealed that species that share more recen common ancestors also tend to have which two features A They are separated by a greater geographical distance B They are biologically more similar to each other C They are geographically closer to each other D They are biologically more different from each other

Humans and gorillas have one amino acid difference in their hemoglobin sequences What does this say about the evolutionary relationship of these two species O A Gorillas recently evolved from humans B They have no common ancestors C They probably have a recent common ancestor D They are probably the same species

Which of the following statements is most likely true of a protein that cotransports glucose and sodium ions into the intestinal cells of an animal A substance that blocks sodium ions from binding to the cotransport protein will also block the transport of glucose Sodium and glucose compete for the same binding site in the cotransporter Glucose entering the cell down its concentration gradient provides energy for uptake of sodium ions against the electrochemical gradient Sodium ions can move down their electrochemical gradient through the cotransporter whether or not glucose is present outside the cell

Movement of molecules and organelles occurs in both directions anterograde and retrograde They generate graded potentials They generate nerve impulses They have many rough ER and Golgi apparatus organelles as they are active in biosynthesis Question 26 2 points 4 Listen Satellite cells function is similar to Schwann cells O astrocytes oligodendrocytes

33 What are the main symptoms of Alzheimer s disease

Which group of fungi include species that are responsible for the recent decline in multiple frog species Oyeasts Ascomycota Chytrids Basidiomycota Zygomycota

Regeneration repair Regeneration fibrosis Restoration striae Mitosis inflammation Question 38 2 points 4 Listen The first step in tissue repair involves replaces it with scar tissue proliferation of fibrous connective tissue inflammation formation of scar tissue

A plant is green because it green light A refracts C absorbs B reflects D transforms

Ih which area of the diagram is most of Earth s phosphorus stor CVDL X O A W B X Phosphorous Cycle W Runoff Sediment Guano Mining Rock weathering Organic animal wastes Z Decomposers Y Land formation

The house fly can serve as a mechanical vector of many parasitic pathogens or eggs thereof The terms phoresis and paratenic both can be used to describe a house fly participating in this behavior Use these terms in A SINGLE SENTENCE to describe the relationship a house fly might have with Entamoeba coli

In a parasitic symbiosis one species lives another species A in the same habitat as C on or in B nearby D harmoniously with

is a symbiotic relationship in which one species benefits and the other neither gains nor loses anything A Mutualism C Commensalism B Co habitism D Parasitism

A typical pioneer species is a n that can breakdown rock to form an area conducive to more diverse forms of life A hearty autotroph C keystone chemotroph B hearty heterotroph D obligate anaerobe