The Living World Questions and Answers

uestion 30 Sudan IV a dye that binds to nonpolar molecules is used to detect the presence of macromolecules in food Sudan IV would test positive in the presence of what macrom points Starch O DNA O Hemoglobin O Chitin O Fats

uestion 29 Egg whites consist primarily of water and the protein albumin When you fry an egg why does the egg white turn from clear to white O The protein becomes dissociated O The protein acquires tertiary structure O The protein becomes denatured O The protein becomes dehydrated

Question 18 Which element s isotope is commonly used to determine when biological samples such as fossils were formed O oxygen O hydrogen O carbon O nitrogen O sulfur

The two most common pathways for fermentation convert pyruvate to lactate or glucose acetyl CoA or lactate acetyl CoA or ethanol lactate or ethanol

You would expect the digestive enzymes of a tropical fish to have peak efficiency at which temperature At or near freezing Around 25 degrees Celcius 10 15 degrees Celcius

Why did the enzymatic rate of activity increase as the temperature increased from 5 C to 35 C but then decrease as the temperature continued to increase from 35 C to 60 C Going from 5 C to 35 C brings the temperature closer to the average body temperature of a bovine but going from 35 C to 60 C goes too far beyond the average body temperature of a bovine Going from 5 C to 35 C brings the temperature closer to the average body temperature of a bovine but after reaching the optimal temperature there is no more enzyme left to continue the reaction

What technological challenges primarily prevent CRISPR I research on human embryos

Why is oxaloacetate an intermediate in the citric acid cycle and why is it regenerated

Communism Socialism Industrial capitalism Agricultural capitalism Feudalism Slave society Primitive communism Figure 1 4 The Marxist stages of history theory ACTIVITY Before you begin to work your way through this book try to find out a bit more about Marxism and its aims before Mao came to power in China When you have done so write a couple of sentences to explain to what extent you think its aims are a achievable and b desirable Marx s ideas inspired many revolutionaries including Mao in China he first attempt to put them into practice was made in Russia lowing the November 1917 Revolution After the Communist Evolution in 1949 Mao tried to adapt and apply these ideas to China Owever practice turned out to be very different from theory and ny have argued that the ideals of Communism have never yet been blemented anywhere This refers to the political and economic writings of one man Karl Marx 1818 83 or two men if Marx s close collaborator Friedrich Engels 1820 95 is included Marx s writings were based on the materialist conception of history that he developed and on his theory that human history was largely determined by the history of class struggles between ruling and oppressed classes which fundamentally had mutually exclusive or conflicting interests Panifest Kommunistischen Partei Ber ffentligt im Jebruar 1848 Proletarier aller L nder vereinigt ruch London Obra is bre Ciha her Bilbange 6eleillehelt f r Arbeite 1 C Ourghard 45 LITEL STAar B Figure 1 5 Front cover of The Communist Manifesto Marx believed that if the workers were successful in overthrowing capitalism they would then be able to construct a socialist society This would still be a class society but one in which for the first time in human history the ruling class would be the majority of the population From this new form of human society Marx believe it would be possible to move eventually to an even better one communism This mauld l

Communist areas in 1934 Mountains Route of the Long March Great Snow Mountains Mao s Route Yan an October 1935 Yangtze R The Great Wall Xian SHAANXI 4th army route Chonging NUBEI HUNAN Beijing Yellow R Nanjing JIANGXI Yangtze R FUJIAN October 1934 3 Shanghai East China sea TAIWAN Figure 1 2 The route of the Long March The Spirit of Yan an Here as in their earlier soviets in the provinces of Jiangxi and Hubei the Communists began to carry out the reforms that had made them popular Such policies won them new recruits and they were also reinforced by other Communist forces that had escaped from the south As a result their Red Army soon numbered over 80000 n 1937 Japan invaded China so beginning the Second Sino Japanese Var though Japanese incursions into northern China had been creasing since their seizure of the Chinese province of Manchuria 1931 As Jiang had been much more concerned to destroy the CP GMD forces had done little to oppose these Japanese incursions Owever the CCP s Red Army had soon used their guerrilla tactics to st the Japanese a consequence despite suffering further losses the CCP s Red Army ed much support from the peasants eventually in December 1936 g s own troops had forced him to form a United Front with the Introduction Communists against the Japanese invaders However Jiang turned once again on the Communists in 1938 In later years the Spirit of Yan an and the Long March were frequently invoked to remind the Party and the people of the sufferings sacrifices and heroism of the first generation leaders of the CCP The final stages of the Civil War After Japan s surrender and the end of the Second World War in 1945 Mao s Red Army was re organised as the People s Liberation Army PLA and in December 1945 a truce between the GMD and the CCP had been arranged by the US and the Soviet Union Mao s earlier resentment of the Soviet Union s attempts to advise the CCP on what tactics to adopt in the civil war was increased by the pressure that Stalin partly as a result of his agreements with the US and the West about spheres of influence placed on the CCP to form a coalition government with the GMD However civil war broke out again in 1946 when Jiang launched a major offensive against the Communists Despite US aid to the GMD the Communists were strong enough by 1948 to move from guerrilla warfare to direct attacks on Jiang s armies During 1948 49 large numbers of GMD troops then began to desert to the PLA and Jiang even lost control of Nanjing his capital Eventually in October 1949 Mao and the CCP were able to claim victory and announce the formation of the People s Republic of China PRC Government in China today Communist China still officially known as the People s Republic of China PRC is a one party state run by the Chinese Communist Party CCP In theory power is shared between the CCP the People s Government and the People s Liberation Army PLA Although the CCP did have a General Secretary at first the most important Party post in practice was that of Party Chairman the first one being Mao Zedong who held the post until his death in 1976 This post however was later abolished under Deng Xiaoping and the role of General Secretary became more important The CCP also has a Politburo which contains the top leaders of the CCP and a Central Committee The Politburo s smaller Standing Committee meets almost continually and comprises the most powerful and influential leaders Th government known as the State Council is headed by a premier

4 Students will write their genetic crosses and plans to generate a double mutant fly

1 Students will write a short summary about how early body plan is established in Drosophila embryos minimum 300 words

The diagram below shows how DNA is sequenced Step 1 5 Step 2 ddCTP ddGTP ddTTP ddATP A T Step 3 STARSA Template strand 5 CGCA 3 Primer 3 GCGT 5 sequence known 5 T CGCA 3 3 AATGTGGGCTATICGGGCGT 5 5 TT CGCA 3 3 ATCTGGGCTATTCGGGCGT 5 Step 5 Step 6 3 Laser Step 4 Electrophoresis 3 A Longest A fragment PATCTGGGCTATICGG Detector G Shortest G fragment 5 3 AATCT GGGCT ATT CGG 5 Step 7 5 TTAGACCCGATAAGCCCGCA 3 babresa sortearE Soitin

Semiconservative replication of DNA involves A each of the original strands acting as a template for a new strand a B only one of the original strands acting as a template for a new strand C the complete separation of the original strands the synthesis of new strands an reassembly of double stranded molecules D the use of the original double stranded molecule as a template E None of the above The enzyme that unwinds the DNA prior to replication is called A DNA polymerase III D primase B DNA ligase E helicase C single stranded DNA binding protein DNA ligase A Keeps the two complementary strands of DNA separated B Untwists strands of DNA CD Links the 3 OH to the 5 PO4 forming the phosphodiester bridge D Processively adds a complementary nucleotide to the 3 end of a new strand o E Synthesizes short RNA primers 3 DNAiguae Por Lopping DNA gyrase 0 35 leading A Keeps the two complementary strands of DNA separated B Untwists strands of DNA C Links the 3 OH to the 5 PO4 forming the phosphodiester bridge D Processively adds a complementary nucleotide to the 3 end of a new strand

Chemical synthesis of DNA Linking first nucleotide to column Removing oligonucleotide from column Purifying oligonucleotide Washing Detritylation Washing Activation and coupling 100 Washing Capping Oxidation n cycles What are the special nucleotide that used in this synthesis How is it different from regular nucleotide The direction of chemical synthesis What are on the platform column What would be the first nucleotide that linked to the platform column 5 GGATCGGAAT 3 How many bases are on the oligonucleotides after n cycles What technique is used to purify oligonucleotides Explain the following steps Detritylation Activation and Coupling Capping and Oxidation including washing after

Plants name Main plant Marigold Tagetes Other plants also included in lab Vinca Catharanthus roseus Begonia Level of soil per pot Pot 1 5 cm Pot 2 7 5 cm Pot 3 12 cm Pot 4 15 cm IV Level amount of soil in the different pots DV Amount of leaves on each branch of the plant within each pot Research Question How does the mass of soil affect the amount of leaves on each branch of a marigold plant Constant variables Watered evenly Same amount of sunlight Same location time span Directions Using the information above please write a few paragraphs answering the questions below in the format of an IB Biology IA Lab report Personal Significance Research question is based on authentic personal interest or curiosity Loignificance is not contrived for example I have always beer

What is the main difference between a hormone and a neurotransmitter Check all that apply ONeurotransmitters act rapidly and with short duration whereas hormones act more slowly and produce effects of longer duration A neurotransmitter transmits a chemical message from an endocrine gland to a target tissue A hormone carries an impulse between neighboring nerve cells A neurotransmitter carries an impulse between neighboring nerve cells O A hormone transmits a chemical message from an endocrine gland to a target tissue Hormones act rapidly and with short duration whereas neurotransmitters act more slowly and produce effects of longer duration

0 Number of plants 30 25 20 5 0 a Wt An b VF Treatments NS Legend All plants were exposed to heat stress Wt wild type plants that have the normal fungal symbiont and the fungus has the normal viral infection An plants that originally did not have the fungal symbiont with the normal viral infection but it was added at the start of the experiment VF virus free plants in which the viral symbiont were removed from the fungus NS nonsymbiotic plants that had the fungal symbiont removed Chlorotic a condition in plants in which leaves produce insufficient chlorophyll NS Dead Chlorotic Healthy This graphic summarizes the results of a study looking at the role of a virus in the ability of the fungus Curvularia protuberata to confer heat tolerance in panic grass This virus normally infects C protuberata Which of the following statements best summarizes the results of this experiment O Plants that have C protuberata removed have greater heat tolerance than those that retain the fungus The presence of the virus reduces the fungus ability to confer heat tolerance on the plants The ability of the fungus to confer heat tolerance on the plants relies on a viral symbiont

According to the video why is it important to learn about these fungi 0 5 If we can prevent our crop plants from being infected with C protuberata we can increase crop yields Climate change has the potential to reduce crop production and the fungus ability to confer thermal tolerance may help us increase cre production Viral diseases are decreasing crop yields and this fungus can protect crop plants from viral infection

The relationship between the fungus Curvularia protuberata and the panic grass found in Yellowstone is an example of a mutualism parasitism commensalism

A African slope B European slope Melanin is a pigment protein that causes cells to become dark in color In fungi melanin is sometimes referred to as fungal armor because it protects fungal cells from a wide range of stressors Researchers in Israel s Evolution Canyon system studied the adaptive melanin response of the soil fungus Aspergillus niger to UV radiation UV radiation causes mutations in DNA Based on your knowledge of the Evolution Canyon system which of the following is a likely difference between populations of A niger found on the African slope AS and the European slope ES Mean melanin concentration is higher on the shady ES than on the sunny AS O Mean melanin concentration is higher on the sunny AS than on the shady ES O There is no reason to expect a difference in melanin concentration between the ES and AS populations

Question 7 Why does an ascus contain 8 ascospores following meiosis which usually results in the production of 4 genetically distin daughter cells The four haploid ascospores undergo an additional round of mitosis after meiosis is complete Meiosis in ascomycetes starts with karyogamy of four haploid nuclei The diploid nucleus undergoes mitosis

With the exception of flagellated spores for members of the Chytridiomycota fungi are mostly nonmotile What adap feature allows them to be such successful decomposers pathogens and symbionts even though they lack motile cells The production of large numbers of easily dispersed spores in sexual and asexual modes of reproduction They are diploid for most of their life cycle They have complex cellular specialization

After making many poor decisions Seth s BAC was over the legal limit What MOST likely caused this to happen O A OB O C O D He abused legal prescription drugs He used illegal drugs He smoked a lot of marijuana He consumed a lot of alcohol

Sabrina is about to take a pill that was legally prescribed when her friend tells her to stop That is not safe Sabrina Don t take it her friend warns Why would this legal drug MOST likely be considered UNSAFE for Sabrina to use It is prescribed by a local doctor It is in a childproof container OC It is classified as a stimulant OD It is prescribed for Sabrina s friend A B

Two weeks ago Alan was prescribed pills for back pain which is now getting better He still has some pills leftover from this prescription What is the MOST appropriate action for Alan to take concerning these pills A If he has no more back pain he can use the pills for any other pains If a friend is also experiencing back pain he can give his pills to them If his back pain flares up in a few days he can still take the pills If the back pain gets worse he can take more pills than were prescribed B C O D

3 But I just kept thinking that my sister s spirit hadn t been killed She up This reservation had tried to suffocate her had kept her trapped in a basement and now she was out roaming the huge grassy fields of Montana a to travel somewhere by walking along the side of the road and asking a driver to take you with them b to walk or wander around somewhere c to raise your middle finger at someone a very rude gesture in the United States Part II Characters Write the correct character in the blank 2 points each 1 And sure was only an adopted stray mutt but he was the only was a better person living thing that I could depend on Honestly than any human I had ever known 2 When gets drunk he sings old country songs And blues too And he sounds good Like a pro Like he should be on the radio He plays the guitar and the piano a little bit But before you think is only good for revenge and kicking the shit out of minivans raindrops and people let me tell you something sweet about him he loves comic books 4 and his friends were laughing like crazy I hated them And I knew I had to do something big I couldn t let them get away with that shit I wasn t just defending myself I was defending Indians black people and buffalo ite one physical body trait and one personality trait for Gordy Use quotes from book with page numbers to support your answers 2 points each

What would happen to the labor market shown below if a wage rate is set at Wed If the wage is free to move what would happen to the wage and the level of employment in this labor market Wage rate Wes Wo Wed 0 So Do

12 Evaluate the statement government can solve insufficient aggregate demand by its spending from the neoclassical perspective

The Congo River stretches from Zambia into the Democratic Republic of the Congo and then in which direction until it reaches the Atlantic Ocean A north B west C east

Who came to the ald of South Korea during the Korean War in the early 1950 s A NATO B The World Health Organization C The United Nations

Name the structure at the end of pointer A Name the structure at the end of pointer B Name the structure at the end of pointer C Name the structure at the end of pointer D A B C D

Watch the video Rat Park Your assignment is to analyze the video presentation to see if the information contained therein is trustworthy Your analysis should be about 3 4 paragraphs in length It is important that you cite references at least one from a peer reviewed journal After you have completed your critic of the Rat Park ask Google s Bard or other artificial intelligence program to critic the Rat Park video Then write a brief summary of the key differences and similarities of your critic and Bard s

In a population of toads average body length is 30mm Body length is variable and the narrow sense heritability for body length is 0 3 for this population You cross a male of 20mm with a female of 22mm What do you expect for the average offspring length O 27 3mm 28 2mm O 21 9mm 25mm 21mm O 22 8mm

Define explain Diffusion using words graphs and or drawings Use terminology learned in class a Create a novel analogy to relate this information to another topic b Give an example of diffusion that you were already familiar with but may not have thought of as diffusion prior to learning this topic

Assume the total real output of a developing country increases from 8 billion to 8 2 billion while its population expands from 14 to 15 million people from one year to the next Over the year real GDP per capita has decreased by 533 per person decreased by 25 per person O increased by 533 per person increased by 25 per person

When using the expenditures approach who usually conducts the largest expenditure of GDP in US US consumers

hen a physician performs an organ transplant they choose a donor whose tissues match those of a recipient as closely as possible Which of the following components of the cell embrane is being matched Ocell surface glycoproteins O None of the choices is correct O nuclear membrane proteins O cytoskeletal elements

A tight junction blocks transport of substances between cells and is made of connexin True False

If GDP grows at 3 each year how long does it take for the GDP to double 3 years O 12 years O 32 years 24 years 6 years

What is NOT a correct statement about the traditional economic system Social institutions determined who does what and who gets what The production capacity of the economy dramatically expanded Social institutions were not effective for organizing production and distribution in a larger group the whole nation Mutual gift giving reciprocity served as a kind of insurance system Penalty for breaking social rules and codes of behavior was social disapproval

Consider Learning Materials 5 as well as the other learning materials and instructor presentations both recorded and live from the structural wave module Respond to this prompt in 250 300 words How have we gone from the success of the Sanitation Movement to stories like those found in readings 4 and 5 in Learning Materials 5 Rural Talk Water the hidden challenge in rural NCLinks to an external site Mention at least one of the readings from Learning Materials 5 Don t forget to provide the reference and citation if necessary Ctrl

US government US businesses Foreigners Question 28 3 points 4 Listen What is the structural unemployment O George used to work in an automotive assembly plant He was laid off six months ago as the economy weakened He expects to return to work when national economic conditions improve Jeanette worked for a company that produces manufacturing goods She recently lost her job when the company moved the factory overseas Sarah moved to a new place and is currently looking for a job botter in that better fits h

Can you change your identity To what extent does the speaker change their Fy identity Your in change for

cutting tropical trees is A is sustainable because new forces replace old forces within a few years B is not sustainable because extensive cutting causes runoff of rain to overfill aquifers c is sustainable because net primary production increases with a rapid regowth of plants d is sustainable as long as the rat of removal equals the rate of recovery e is sustainable because it decreases biodiversity

Identify the cells found within the tissue shown Submit Previous Answers Request Answer A B

Why did China decline into warlordism after Yuan Shikai s death On Yuan Shikai s death a confused period of infighting among Beijing army commanders followed from which General Duan Qirui Tuan Chi jui emerged as premier Although his authority was very limited since central rule was breaking down in China he attempted to crush his opponents by force This resulted in violent clashes on the streets of Beijing Hoping to exploit the disturbed atmosphere General Zhang Xun Chang Hsun marched on the capital in June 1917 with the aim of restoring the Qing dynasty Zhang s efforts ended in confusion and failure and Duan Qirui retained office as premier The weakness of the republic The disorder and vying for power at the top that followed Yuan s death in 1916 clearly illustrated that central authority in China had become enfeebled The republican government under Duan Qirui continued nominally to function in Beijing but it exercised little real power It was split between rival factions the most prominent being the Anhui the Fengtien and the Chihli groups named after the regions from which they came Although they styled themselves parties none of them represented a clearly defined principle and they were barely distinguishable from each other They were no more than cliques bidding for power While the forms of central government remained intact it was evident that the republic was beginning to fragment The weakness of the republican government was most evident in its difficulty in maintaining an army strong and loyal enough to impose central authority on the provinces It became impossible to sustain civilian government in these areas As a direct consequence the local regions fell under the domination of what were in effect a series of private armies whose commanders in chief assumed civil as well as military authority The power of the sword predominated Within their own provinces the military commanders or warlords became autocrats who administered their own legal financial and taxation systems and invariably became a terror to the local people The

1 g L is equal to 0 001 g mL O 1000 mg L O 100 ng mL O 1000 ng L Question 6 1 point 0 1 mg L is equal to O 100 ng L O 0 001 g L O 100 g L

In your own words tell a me a lil in on nature

3 Capillary action happens when A B Gravity is stronger than adhesion Adhesion to the wall is stronger than the cohesive forces between the molecules The surface tension breaks and gravity takes over