The Living World Questions and Answers

Three Proteus vulgaris Two S m and P v will be under the positive glucose fermentation to acid and P p will be under the branch for the negative reaction PR L S m and P v will be under the negative glucose fermentation to acid and P p will be under the branch for the positive reaction Serratia marcescens One Pseudomonas aeruginosa The number of columns gives the number of steps roups alendar Inbox History DD People Office 365 YuJa LAMC Tutoring Welcome Center Library NetTutor When creating a dichotomous key what test can be used to separate these bacilli into two branches If you start with PR G fermentation of glucose into acid how would the names of the bacilli be separated What is the minimum amount of steps needed to separate these three bacilli in a dichotomous key A step is a test Which of these microbes is Choose Choose Choose Proudomonas aeruginosa est

lowing paragraph and table to answer the questions that follow Points for each the data estion are in bold at the end of the question Organisms get energy from the food they eat but the energy contained in foods varies greatly Most foods contain a combination of proteins carbohydrates and fats One gram of protein or carbohydrate such as glucose contains roughly 4 Calories One gram of fat however contains about 9 Calories The table below shows the approximate composition of one serving of some common foods Composition of Some Common Foods Protein g Food Apple 1 medium Bacon 2 slices Chocolate 1 bar Eggs 2 whole 2 milk 1 cup Potato Chips 15 chips Sourdough bread 2 slices Skinless roasted turkey 3 slices 0 5 3 12 8 2 8 11 Carbohydrate g 22 0 23 0 12 14 36 3 Fat g 0 6 13 9 5 10 1 1 17 Per serving which of the foods included in the table has the most protein Which as the most carbohydrates Which has the most fat 4pts 18 Approximately how many more Calories are there in 2 slices of bacon than there are in 3 slices of roasted turkey Why is there a difference 4pts 19 Walking at a moderate pace consumes around 300 Calories per hour At that rate how many minutes would you have to walk to burn the Calories in one chocolate bar Show work Explain your answer 3

B It is common for cancer cells to have lost p53 activity Based on what you know about p53 function and regulation what regulatory mechanisms might be disrupted in p53 that could lead to a cancerous phenotype List two specific examples and explain Bullet point your response for easier grading

Observe the following table of biochemical tests and Gram negative bacilli Answer the questions below by choosing the best answer from the pull down menu Fermentation and Oxidation in Gran Negative Bacilli Serratia marcescens Proteus vulgaris PR PR PR Glucose Lactose Sucrose acid acid acid Pseudomonas putida When creating a dichotomous key what test can be used to separate these bacilli into two 4 2 Choose O F Test FA OA FA

Observe the growth of bacterial colonies on these plates Which dilution factor plates would not be appropriate to use to determine bacterial concentration Why Exercise 5 results 10 105 10 106 104 107

Cells bacterial or eukaryotic are always transcribing and translating all coding DNA regardless of environmental conditions True

The normal DNA sequence is ATC GGC TAA TCC The mutated DNA that shows a frameshift mutation is O ATC GCT AAT CC O ATC GGC TAC TCC

under very different cif the voice and tone of each selection However there are some similarities between the texts as well Review your annotations and notes to find similarities and differences in voice and tone in the two works In a small group discuss how the voice and tone in these two works compare Then work together to complete the chart with examples from each text that illustrate tone or voice In the third column note if you think the examples are similar or different Tone Voice LETTER TO JOHN ADAMS LEAN IN COMMENTS ANALYZE THE TEXTS Discuss these questions in your group 1 Infer Do you think the two women would agree on what makes an ideal marriage Explain using examples from each text 2 Synthesize How do Adams s comments about the approaching revolution suggest that she would have appreciated Sandberg s advice on pursuing success 3 Compare Though the two writers have different styles they have energy and passion in common Use evidence from the texts such as details related to style or tone that demonstrate their energy and passion 4 Evaluate What do these two works suggest about how involved the Pulding Compon

Part 5 Conclusion Analyze the data from your lab to help answer the following question How can abiotic factors affect sea urchins and the kelp forest ecosystem CLAIM EVIDENCE

In our Theory of Knowledge class students discussed their thoughts on the question What is art in a socratic seminar Students came to the consensus that art can mean many things and take on many different forms One student suggested that art is a physical representation of people s emotions According to them art invokes one or more of the senses like touch or taste Another student suggested that art is characterized by its usage of artistic elements like form and texture A third student suggested that art can also be a form of political protest They provided the example of a fashion show where everything the artists wore broke to demonstrate the ills of fast fashion I think that all three student s views basically encompass the essence of art I think that art can be defined by its purpose as well as the tools used to create it The conversation veered onto the topic of art s value One student suggested that humans value art based on how much we can interpret it Therefore professional artists can interpret things better compared to a regular person Another student disagreed with this arguing that art s value is not conditional on the person viewing it and that art has inherent value I personally agree with the second student An art piece s message doesn t waver depending on the person who views it Art is always subject to human interpretation Human interpretation is subjective but this doesn t disregard the art s value

Over the past 500 million years there have be en mass extinctions and each time at least species on Earth became extinct O twelve 96 O two 25 O seven 25 O seven 25 of the

f all of Earth s history were compressed into 24 hours would first appear less than 10 minutes ago Land plants Animals Paleozoic Multicellular eukaryotes Single celled eukaryotes Meso zoic Ceno zoic Proterozolc Archaean Eo Eon Billions 2 Humans of ago years Atmospheric oxygen Origin of solar system and Earth Prokaryotes

Question 1 O O There are 5 10 20 amino acids that are used by organisms for protein synthesis 0 5 pt

Components O Brown tube Phusion HF buffer Blue tube TPS Green tube RNA forward Pink tube RNA reverse Yellow tube A template Clear tube usion DNA polymerase tal volume of the stock sample 5X 10 mM 10 M 10 M 0 05ng L 2 U L concentration in reaction tube 1X 0 2 mM 0 2 M 0 2 M 0 5ng 100 L 1U 100 L per reaction Positive control L 63 5 L 20 0 L 2 0 L 2 0 L 2 0 L 10 0 L 0 5 L 100 L per reaction Negative control L 73 5 L 20 0 L 2 0 L 2 0 L 2 0 L 0 5 L 100 L

1 Rita has watched as her mom has been diagnosed with two different types of cancer and type 2 diabetes Her mom hasn t eaten well her entire life and hasn t led a very active life Rita wants to try her hardest to avoid diseases and to improve her quality of life How can Rita s relationship with nutrition affect her quality of life and risk for disease What are three specific actions she can take to try to decrease her chances of disease and improve her quality of life 2 Terrance was recently diagnosed with high cholesterol His doctor wants him to make changes to his individual diet plan to help him eat more nutritious foods and fewer empty calories What is the best way for Terrance to make these changes What are three questions he could ask himself to help determine what changes need to be made If you were in Terrance s situation what three changes would you make 3 Kendra wants to lose weight However every night after work it s most convenient for her to stop at a fast food restaurant where she eats a cheeseburger and fries Before going to bed she eats ice cream and potato chips What are some healthier alternatives she could try to help her lose weight What are other ways she can enjoy healthier foods 4 Jamal has found a supplement at his health food store that claims to cause a person to lose 10 pounds a month He asks you if he should take it How would you respond What are some ways you could teach Jamal to critique the validity of health products How will Justin know if this product is safe and effective 5 You notice your friend has been skipping meals lately and appears to be losing a lot of weight How would you respond in this scenario What are two ways you might help your friend make positive health choices

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Where do axons that travel through the posterior root ganglion terminate in the posterior columns O in the anterior horn O in the anterior columns in the posterior horn

What kind of chemical reactions does it involve Ouncatalyzed oxidation Ouncatalyzed hydrolysis enzyme catalyzed hydrolysis enzyme catalyzed oxidation

Where does digestion occur in the body Check all that apply in the stomach in the dodecadactylon in the small intestine in the liver in the large intestine in the mouth

Match each of the following functions with the the graph that best describes the situat a The cost of building a house as a function of its square footage b The height of a rock dropped from a 300 foot building as a function of time c The height of a human as a function of time 1 d The demand for pizza as a function of price e The height of a child on a swing as a function of time m w rz 11 M

3 Consider the diagram below that depicts a transcription bubble Which letter s could represent proper transcripts 3 5 W Y X Z 5 m

16 6pts Write out the reactants products and enzyme names for the reactions that release free glucose from glycogen

1 What are some examples of structural modifications of cells that increase surface area a what would happen to intestinal cells lost the ability to fold 2 How does the surface area to volume ratio affect the rate of heat exchange with the environment 3 How are specialized structures and strategies used by cells and organisms for the efficient exchange of molecules with the environment a describe an example of this process for elephants b describe an example of this process for plants 4 Skill practice What is the answer in the skill practice Also show calculations for how the density ratio was

The leading and the lagging strands of DNA differ in that the leading strand is synthesized at twice the rate of the lagging strand the lagging strand is synthesized continuously whereas the leading strand is synthesized in short fragr that are ultimately stitched together the leading strand is synthesized by adding nucleotides to the 3 end of the growing strand and the lag strand is synthesized by adding nucleotides to the 5 end

An actively dividing bacterial culture is grown in a medium containing radioactive adenine A After all the adenine is labeled the bacteria are transferred to a medium containing nonradioactive adenine A Following one round of DNA replication in the nonradioactive medium the DNA is analyzed Which of the following sequences could represent this DNA A ATTGA TC TTAACTAG A ATTGATC TTA A CTAG AATTGATC

Order the steps in binary fission from first to last starting at the top i Instructions The bacterial DNA molecule begins replication The cell elongates and the replicating DNA is partitioned such that the origins are at the 1 4 and 3 4 positions in the cell Septation begins

Which sentence from the articla BEST Supports the conclusion that growing large pumpkins is a time consuming process Travis Gienger has been growing A enormous pumpkins for nearly 30 yours 2 Each year he and dozens of other gourd growers haul their overgrown winter squash to Half Moon Bay Ca fomnia Gienger starta planting seeds in his backyard pumpkir patch in mid Even though he has been growing P

ces below and write your opinion about Universal Basic Income and Job Guarantee Program Include but not be limited to the discussions of the strengths weaknesses of each program Which one do you think is the best for US economy If you have a better idea or program please share it as well Feel free to research listed resources below The word limit is 400 500 more about the programs beyond the Video https www youtube com watch v eec9iFfmxbw https www youtube com watch v EoU2YL3hWvk https www youtube com watch v UqESogRgrYw

9 What are Keynes major critiques of neoclassical theory

2 Compare various bones of Monkey and compare them to Humans Figs 3 4 and 4b Skeletal Part Tail bones present or absent Shape of pelvis Shape of spine Shape of clavicle Opposable first toe on foot present or absent Opposable thumb present or absent Prehensile foot can grip present or absent Where does the skull attach to spine Where do the Femur attach to Pelvis Monkey Human

7 Explain the conventional role myths of the State held by the public and the actual role played by the State according to Mariana Mazzucato

Question 14 Studying bes To study motor function on microtubules scientists can create purified stable fluorescently labeled microtubules and motors different colors and watch movement of the kinesin walking along the microtubule using a fluorescence microscopy This allows scientists to analyze the kinetics of kinesin movement velocity of movement what regulates movement etc A How might you expect that molecular biologists create stable and labeled microtubules for this experiment To create stable and labeled microtubules for this experiment they would likely polymerize purified tubulin into microtubules in the presence of a fluorescent marker or dye The addition of a stabilizing agent like taxol can help block the microtubules dynamic instability and promote stability B Based on what you know about how kinesin motor activity is regulated by ATP ADP and nucleotide release what do you think would happen if you added only ADP to this experiment rather than ATP Would the kinesin ever bind the MT Would you observe the kinesin walking on the microtubule The movie 17 7 in the movies folder in Moodle might be helpful for this question Bio285 F23 If you only added ADP rather than ATP to this experiment the kinesin would bind to the microtubule because ADP bound kinesio has a good affinity for the microtubule That would cause a conformational change leading to ADP dissociating from the binding pocket Since there s no ATP to diffuse into the binding pocket of kinesio and cause the neck linker to change conformation and cause walking kinesin would bind to ADP and remain bound to ADP and therefore bound to the microtubule and no walking is observed C Based on what you know about how kipesin motor activity is regulated what do you think would happen if you added a n00 hdolzable ATP analog to this experiment Would the kinesin ever bind the MT Would you observe the kinesin walking on the microtubule Here is a structure of an example 000 bydrolyzable ATP analog ATP y S S 0 O P P P NH Topic 6 Problem Set Answer Key N O Francis N N

Question 8 Microtubule Polymerization Assay You are working in a lab that studies microtubule dynamics Being the eager researcher that you are you wake up at the crack of dawn on Monday morning to start your first in vitro experiment studying the dynamics of microtubule polymerization You add GTP and purified tubulin to a test tube and observe microtubule polymerization in vitro You take some samples at a few time points up until 11am but stop because you need to leave for Bio285 lecture you don t want to be late to Bio285 lecture after all and observe the following Bio285 F23 Topic 6 Problem Set Answer Key L2 time amount of polymer Francis A If you had more time to take additional timepoints over the next hour how would you expect the shape of the curve to change during that time Draw what the graph would look like and explain what is happening at the molecular level B If you continued to take time points throughout the night and into the next day how would you expect the shape of the curve to change Draw what the graph would look like and explain what is happening at the molecular level

In this diagram of a salt wedge estuary which layer is the halocline Press the hotspot to show your answer Seawater Types of Estuaries 15 10 33 O O River water 5 Salt wedge estuary

Showing

The trouble with indicting President Trump is this If we start going after him next we ll be going after President Biden President Obama senators representatives governors Pretty soon no elected official will be safe from partisan attack This is a classic example of a fallacy called O Slippery Slope O Hasty Generalization O Faulty Analogy

It is in every case immoral to lie to someone even if the lie could save a life Even in extreme circumstances a lie is still a lie All lies are immoral because the very act of prevarication in all circumstances is contrary to ethical principles This is a classic fallacy of O Appeal to Tradition Begging the question O Hasty Generalization

Which of the following descriptions best captures the difference between a euphemism and a dysphemism O A euphemism is employed to create a negative effect on a reader s attitude and a dysphemism is employed to create a positive effect on a reader s attitude O A dysphemism is employed to create a negative effect on a reader s attitude and a euphemism is employed to create a positive effect on a reader s attitude O A cuphemism is a form of rhetoric but a dysphemism is not O A dysphemism is a form of rhetoric but a euphemism is not

No one objects to a lawyer looking up a legal case during a trial Why then shouldn t students be permitted to look up an answer during an exam O Begging the Question O Slippery Slope O Faulty Analogy False Dilemma

All Jews are tight with their money Identify the rhetorical device involved here O Innuendo O Begging the question Stereotype

Uniforms are required in many public service occupations Police Officers and Firefighters for example are required to wear uniforms on the job Elementary school teachers hold public service positions Isn t it reasonable to require them to wear uniforms too O Hasty Generalization O False Alternatives O Appeal to Ignorance O Faulty Analogy

People who support the Hamas government may refer to those fighting against the government as rebels or terrorists Identify the rhetorical device involved here O Euphemism Hasty generalization

Three of the ten finalists in this year s essay contest came from Fayetteville State University They must really have a great writing program I think I ll transfer my children there O Faulty Analogy O Slippery Slope O Begging the Question

Seen below is a longitudinal section of a moss capsule containing spores What is the ploidy of the structures indicated by number 27 22 7 3 Time left 0 15

F5

PII O FG P

Alt