The Living World Questions and Answers

22 Referring to the genetic code presented in Figure 15 10 give the amino acids specified by the following bacterial mRNA sequences a 5 AUGUUUAAAUUUAAAUUUUGA 3 b 5 AGGGAAAUCAGAUGUAUAUAUAUAUAUGA 3 c 5 UUUGGAUUGAGUGAAACGAUGGAUGAAAGAUUUCUCGCUUGA 3 d 5 GUACUAAGGAGGUUGUAUGGGUUAGGGGACAUCAUUUUGA 3

7 Look up the following organisms Paramecium Spirogyra Oscillatoria Saccharomyces Which one of these organisms has no organelles 8 Which of these molecules is a polymer glucose amino acid glycogen or nucleotide 9 A buffer is a chemical that returns the pH of a solution to neutral whether the solution is basic or acidic If a solution is acidic will a buffer reduce the amount of hydrogen ions or hydroxide ions to make it neutral

3 How might pregnancy influence a urinalysis test result

70 Cells that go through mitosis do not possess homologous chromosomes True or False 71 A parent that is homozygous dominant for a trait cannot have a child that expresses the recessive phenotype True or False

The vaccine against tetanus is this kind of vaccine O Inactivated O Toxoid O Attenuated

72 What term is used for programmed cell death 73 Which pattern of inheritance results in a blending of two phenotypes in heterozygotes that presents an intermediate form codominance incomplete dominance or sex linked 74 If you were to observe sample of plant or animal tissue and look at the hundreds of cells within in which major portion of the cell cycle do you think you would find most of them

1 Viruses are not living organisms but they do have one characteristic of life that makes them difficult to eradicate Which characteristic is it

3 1 point There are 4 amino acids below Draw a large RECTANGLE around the one Polar amino acid Draw a large CIRCLE around the one Basic amino acid CH3 H N C COO H OH CH H N C COO H Farina Ser O C CH H N C COO H Aspartic acid Asp NH3 CH 1 CH CH CH H N C COO H Lysine Lys

4 What term do we use for the electrons in the outermost shell of an atom 5 Suppose one atom of P has an atomic mass of 31 and another atom of P has an atomic mass of 32 Which subatomic particle is responsible for the heavier mass proton neutron or electron 6 If you pull two water molecules away from each other what kind of bond are you breaking

Crumb pickers O A Are scavengers B Have high giving up densities C Have low giving up densities OD Are mesopredators

22 Which of these is an example of simple diffusion A the movement of small bacteria away from high concentrations of solutes B the spread of a gas through the air of a classroom C the buildup of water in tissues D the maintenance of a concentration gradient by a membrane protein 23 Which process will require ATP exocytosis gas exchange or osmosis

Acid A red B green When using Universal Indicator Paper acids will react and turn the paper C blue The pH Scale D silver 10 Bas II

1 point Match the correct RNA bases to this DNA strand T A C C A T A G A T G G G

1 point Match the correct DNA bases to this DNA strand A G T C A T G T T G C A

The firmware on one of your network routers is out of date so you download the latest version of the firmware from the manufacturer s website Which order should you complete the following steps in to flash the firmware on the router Drag Execute the firmware update Make sure the router is not turned off or interrupted until the update is complete Back up the router s current firmware configuration Connect to the router from a computer on the network Drop Step 1 Step 2 Step 3 Step 4

Examples of specialization areas in biomechanics include all of the following EXCEPT O plant biomechanics O animal biomechanics O molecular biomechanics Opsychological biomechanics

Before 1980 it could take hundreds of hours to track the movements of participants in a research study False O True

How was the war in Europe different than the war in the Pacific

Which species is most OA Grey fox B White footed mouse OC Opossum OD Chipmunk QUESTION 8 The mechanism of succession that is less likely to occur is OA Individualistic model B Inhibition model C Facilitation model

OA Loss of sink species loss of irreplaceable species loss of evolutionary novelty B Loss of irreplaceable species loss of sink species loss of evolutionary novelty O C Loss of irreplaceable species loss of evolutionary novelty loss of sink species D Loss of evolutionary novelty loss of sink species loss of irreplaceable species QUESTION 22 The decline of vulture populations costs India OA 26 billion USD B 15 billion USD C 26 million USD

Scenario Use the tracert command from Wrk1 to answer the following questions How many routers are there between Wrk1 and Wrk3 What is the IP address of the last router in the path between Wrk1 and Wrk2 Click Done when you ve found the information you need to answer the questions Exhibits Wrk1 214 60 198 2 Network Wrk2 198 115 21 11 Wrk3 208 52 181 110

The coffee club study from the UK showed OA People tend to cooperate more when the image of eyes was staring back at them O B People tend to cheat more when the image of eyes was staring back at them C People tend to cheat more when the image of flowers is in front of them D People tend to cooperate more when the image of flowers is in front of them

The first person in the family represented by the pedigree shown here who exihibited symptoms of the mitochondrial disease MERRF was II 2 Check all possible explanations of why the mother 1 1 was unaffected but her daughter I1 2 was affected I Check All That Apply U U 2 2 3 4 3 The father 1 2 was homoplasmic for mutant mtDNA The mother 1 1 was heteroplasmic for wild type and mutant mtDNA The father 1 2 was heteroplasmic for wild type and mutant mtDNA A spontaneous mutation occurred in the mtDNA of the mother s germ line cells A spontaneous mutation occurred in the mtDNA of the zygote that became individual 11 2

Which of the following is FALSE regarding COVID 19 O a it binds to the protein ACE 2 on the host cell Ob it can infect various species of animals Oc it is a member of the family of coronaviruses O d it is a retrovirus

228 QUESTION 28 DOK 2 1 ALIGNED STANDARD 1 points Which statement BEST summarizes Beatty s explanation about how it all started SELECT AN ANSWER O The war forced citizens to pay more of their attention to fighting and supporting the war machine O All books and magazine were replaced with movies and television O All forms of literature and entertainment were shorted to make them easy to consume O Because of the population boom there was an audience for a greater variety of stories

Which of the following is FALSE regarding the delta agent O a it is found in cases of hepatitis B Ob it is a human pathogen Oc it is a virus Od it is made of RNA Stry

QUESTION 31 DOK 2 1 ALIGNED STANDARD 1 points What or whom is Mildred referring to when she says she is tired of listening to this junk SELECT AN ANSWER O her family bickering O the television walls O Beatty O Montag

Bats often are the reservoir for major human viral pathogens because a bats have effective immune systems which enable them to tolerate many viral pathogens b bats have elevated temperatures while flying which selects for fever tolerant viruses c bats often live close together in small spaces enabling viruses to easily spread among them d all of the above e none of the above

SARS CoV 2 is a an enveloped RNA virus Ob a non enveloped DNA virus Oc an enveloped DNA virus d a non enveloped RNA virus

Viruses which lead to transformation of a host cell are referred to as subclinical latent oncogenic

A person is required to take 1 mg and 5 mg prednisolone tablets in a tapering dose regimen of 25 mg for 4 days then reducing by 3 mg ever 3 days until the course is finished How many 1 mg tablets would be required Re

The current COVID 19 vaccine is becoming less effective with time because a the virus is mutating b people are becoming resistant to the vaccine O c people are becoming resistant to the virus d all of the above e none of the above

Q29 QUESTION 29 DOK 2 1 ALIGNED STANDARD 1 points Why aren t there porches anymore SELECT AN ANSWER to prevent people from thinking O to record who enters and exits homes O to encourage a healthy lifestyle O to stop neighborhood vandalism SUB

QUESTION 25 DOK 2 1 ALIGNED STANDARD 1 points What is Mildred s attitude toward Montag in this scene SELECT AN ANSWER O indifferent O afraid O mean O caring

QUESTION 32 DOK 2 1 ALIGNED STANDARD 1 points What is the BEST inference that can be drawn from the presence of the books SELECT AN ANSWER O Montag has figured out that his wife has a secret stash of illegal books O Montag has been collecting books for a substantial period of time O Montag stole as many books as he could carry at the last fire Montag teaches other people how to read books and gain knowledge from them

Which of the following statements is TRUE regarding viroids a they only infect plants Ob they are made of RNA Oc they cause stunted growth of their host d all of the above are true

b What is the ratio of the weight of the bird vs the carrying capacity flight

Biology Birds a Describe the process of egg formation i birds

QUESTION 7 DOK 2 1 ALIGNED STANDARD 1 points What happened on this page SELECT AN ANSWER O Mildred died and jet bombers screamed O Mildred overdosed and jet bombers screamed Mildred died and Montag screamed as loud as a jet bomber O Mildred overdosed and Montag screamed as loud as a iet bomber

What are the sources of pH dependent charge in soil Multiple answers Multiple answers are accepted for this question Select one or more answers and submit For keyboard navigation SHOW MORE Broken Clay Sheets b Isomorphic Substitution c Functional Groups of organic matter d Free Radicals

The bicarbonate ion HCO3 is an example of a an cation acid solvent base

How often should you flame your loop when doing the streak plate technique don t need to flame the loop at all O only once before you make the 1st streak O only once before you make the last streak before making each streak and after you are done twice once before making the 1st streak and once after making the last streak

Why do we flame the tool loop before and after obtaining the bacteria Prevents the bacteria we obtained from contaminating our lab eg our lab table and anything on the table Prevents both microbes from the environment already on the tool from contaminating the experiment and bacteria we got from the tube from contaminating the lab Prevents microbes from the environment already on the tool from contaminating our experiment Heating the tool warms up the tool and this helps the bacteria we obtain to multiply better Heating the tool helps the bacteria to stick better to the tool and makes it easier for us to get the bacteria

A streak of bacteria on MacKonkey plate is beige not red This tells you the bacteria does not ferment mannitol ferments glucose ferments lactose ferments mannitol does NOT ferment lactose

extra credit if you need to find out whether an unknown gram negative bacillus shaped bacteria is an enteric or NOT in order to identify it which test would you use SIM sulphur indole motility test media fermentation phenol red test decarboxylase decarboxylation test citrate test

extra credit we want to find out if our bacteria can ferment mannitol into acid however we do not know whether our bacteria is a halophile or not and there s no way for us to find out whether it can tolerate high salt conditions which media should we use in this case Bile esculin plate test fermentation or phenol red broth containing the appropriate sugar MSA mannitol salt agar plate Mackonkey s plate O EMB eosin methylene blue plate gelatin deep test

The Northeastern Japan Arc is the result of the Pacific Plate and the Okhotsk Plat each other

In the streak plate technique how should the last streak touch the previous one O it should NOT touch the previous streak at all every stroke zorro sign should touch the previous streak only the 1st 1 or 2 zorro signs strokes should touch the previous streak only the LAST zorro sign stroke should touch the previous streak

The bacteria in the question above should be Micrococcus Staphylococcus aureus a species of Staphylococcus that is NOT aureus E coli a gram negative bacteria that ferments lactose

Which of the following tests media requires you to add reagent chemical s AFTER incubation in order to see the results thioglycollate broth Ophenol red broth fermentation broth O decarboxylation broth urea agar slant nitrate broth