The Living World Questions and Answers
![In the fossil record we see evidence of bipedalism before large increases in brain size Which of the following hypotheses attempt to explain why our lineage starts walking on two legs check your answer in section 5 Hands Free for Art early hominins need their hands for cave painting Assimilation Model apes are replaced by other hominins O Running Hypothesis early hominins were efficient bipeds and could run faster than quadrupedal predators The Savannah Hypothesis forests started to disappear in parts of Africa where these early hominins lived](https://media.kunduz.com/media/sug-question-candidate/20231213030600975619-4116583.jpg?w=256)
Biology
The Living WorldIn the fossil record we see evidence of bipedalism before large increases in brain size Which of the following hypotheses attempt to explain why our lineage starts walking on two legs check your answer in section 5 Hands Free for Art early hominins need their hands for cave painting Assimilation Model apes are replaced by other hominins O Running Hypothesis early hominins were efficient bipeds and could run faster than quadrupedal predators The Savannah Hypothesis forests started to disappear in parts of Africa where these early hominins lived
![For the results section of a paper which of the following sentences would be the best to include A Liver contains a lot of catalase so that it can detoxify substances B The foam layer reached 11 2 mm though it was difficult to measure since it disappeared rapidly C The control did not demonstrate any catalase activity D After the addition of 2 drops of liver extract the tube was placed at room temperature for one minute then the foam layer was measured to be 2 mm](https://media.kunduz.com/media/sug-question-candidate/20231213012839707524-3667276.jpg?w=256)
Biology
The Living WorldFor the results section of a paper which of the following sentences would be the best to include A Liver contains a lot of catalase so that it can detoxify substances B The foam layer reached 11 2 mm though it was difficult to measure since it disappeared rapidly C The control did not demonstrate any catalase activity D After the addition of 2 drops of liver extract the tube was placed at room temperature for one minute then the foam layer was measured to be 2 mm
![Which term refers to an individual s outward appearance with respect to a specific characteristic phenotype heterozygous genotype homozygous](https://media.kunduz.com/media/sug-question-candidate/20231212184736438926-4553535.jpg?w=256)
Biology
The Living WorldWhich term refers to an individual s outward appearance with respect to a specific characteristic phenotype heterozygous genotype homozygous
![A garden pea plant possesses one allele coded for yellow seed colour and one allele coded for green seed colour Which statement is true The individual is homozygous for the seed colour allele The individual is heterozygous for the seed colour allele The allele for green seed colour is always dominant none of the above](https://media.kunduz.com/media/sug-question-candidate/20231212184756770535-4553535.jpg?w=256)
Biology
The Living WorldA garden pea plant possesses one allele coded for yellow seed colour and one allele coded for green seed colour Which statement is true The individual is homozygous for the seed colour allele The individual is heterozygous for the seed colour allele The allele for green seed colour is always dominant none of the above
![Which term refers to the allele that if present is always expressed O dominant allele O X linked Orecessive allele Y linked](https://media.kunduz.com/media/sug-question-candidate/20231212184642356944-4553535.jpg?w=256)
Biology
The Living WorldWhich term refers to the allele that if present is always expressed O dominant allele O X linked Orecessive allele Y linked
![The gene for stem length in a garden pea plant results in either tall or dwarf 1p stems with tall being the dominant trait Pretend you are a geneticist and for the purpose of an investigation you would like to determine if a tall pea plant is homozygous dominant or heterozygous What type of pea plant should you cross the plant with to make this determination homozygous recessive homozygous dominant heterozygous none of the above](https://media.kunduz.com/media/sug-question-candidate/20231212184626259489-4553535.jpg?w=256)
Biology
The Living WorldThe gene for stem length in a garden pea plant results in either tall or dwarf 1p stems with tall being the dominant trait Pretend you are a geneticist and for the purpose of an investigation you would like to determine if a tall pea plant is homozygous dominant or heterozygous What type of pea plant should you cross the plant with to make this determination homozygous recessive homozygous dominant heterozygous none of the above
![EST 2 1 The steepest angle material remains stable on a slope is a A daylight bed b Completely dependent on the water absorbed by slope c The angle of repose d Referred to as a hummocky surface 2 Slip planes are a Potential zones of weakness is sedimentary rocks Clay layers in metamorphic rocks b c Often found on convex and concave surfaces d The cause of rotational slides 3 If the safety factor is greater than one 1 a Soil creep will result b Rotational slides will be frequent Resisting forces will exceed driving forces d Driving forces will exceed resisting forces](https://media.kunduz.com/media/sug-question-candidate/20231212070259981829-4102346.jpg?w=256)
Biology
The Living WorldEST 2 1 The steepest angle material remains stable on a slope is a A daylight bed b Completely dependent on the water absorbed by slope c The angle of repose d Referred to as a hummocky surface 2 Slip planes are a Potential zones of weakness is sedimentary rocks Clay layers in metamorphic rocks b c Often found on convex and concave surfaces d The cause of rotational slides 3 If the safety factor is greater than one 1 a Soil creep will result b Rotational slides will be frequent Resisting forces will exceed driving forces d Driving forces will exceed resisting forces
![1 What are the three ethnic groups that we focus on in Southwest Asia 2 What are the three religious groups that we focus on in Southwest Asia 3 What event caused the conflict among the ethnic and religious groups in Southwest Asia 4 Why is water supply a huge issue in Southwest Asia 5 What is the most common landform in Southwest Asia and how does it affect where people live 6 Why are the countries of Southwest Asia in conflict with one another 7 Describe how land and religion play a role in continuing conflicts in the Middle Ea Fxplain the difference between an ethnic group and a religious group](https://media.kunduz.com/media/sug-question-candidate/20231211211442880391-4426144.jpg?w=256)
Biology
The Living World1 What are the three ethnic groups that we focus on in Southwest Asia 2 What are the three religious groups that we focus on in Southwest Asia 3 What event caused the conflict among the ethnic and religious groups in Southwest Asia 4 Why is water supply a huge issue in Southwest Asia 5 What is the most common landform in Southwest Asia and how does it affect where people live 6 Why are the countries of Southwest Asia in conflict with one another 7 Describe how land and religion play a role in continuing conflicts in the Middle Ea Fxplain the difference between an ethnic group and a religious group
![estment have decreased by 2 million If no other line items such as ports for a small country have increased by 4 million consumption government spending and import change how much will GDP change GDP will increase by 6 million GDP will decrease by 2 million GDP will increase by 2 million GDP will decrease by 6 million Question 48 2 points Saved Listen If GDP grows at 6 each year how long does it take for the GDP to double 3 years 12 years 6 years 24 years](https://media.kunduz.com/media/sug-question-candidate/20231209040002122134-4426152.jpg?w=256)
Biology
The Living Worldestment have decreased by 2 million If no other line items such as ports for a small country have increased by 4 million consumption government spending and import change how much will GDP change GDP will increase by 6 million GDP will decrease by 2 million GDP will increase by 2 million GDP will decrease by 6 million Question 48 2 points Saved Listen If GDP grows at 6 each year how long does it take for the GDP to double 3 years 12 years 6 years 24 years
![employment government spending tax revenues inflation Question 46 2 points Saved 4 Listen When the general price level in our economy increases which of the following effects does NOT occur The purchasing power of people s savings will increase Foreign buyers will buy less of our output and we tend to import more The interest rate will also tend to increase](https://media.kunduz.com/media/sug-question-candidate/20231209035947985022-4426152.jpg?w=256)
Biology
The Living Worldemployment government spending tax revenues inflation Question 46 2 points Saved 4 Listen When the general price level in our economy increases which of the following effects does NOT occur The purchasing power of people s savings will increase Foreign buyers will buy less of our output and we tend to import more The interest rate will also tend to increase
![B goods and services in each year multiplied by each year s price index the output of goods and services in each year multiplied by the prices in the base year the output of goods and services in each year multiplied by each year s prices nominal GDP multiplied by the price index Question 42 2 points Saved 4 Listen If your nominal income has gone up 5 and inflation has simultaneously increased by 6 what would happen to your real income decreased by 1 O decreased by 11 increased by 1](https://media.kunduz.com/media/sug-question-candidate/20231209035911208937-4426152.jpg?w=256)
Biology
The Living WorldB goods and services in each year multiplied by each year s price index the output of goods and services in each year multiplied by the prices in the base year the output of goods and services in each year multiplied by each year s prices nominal GDP multiplied by the price index Question 42 2 points Saved 4 Listen If your nominal income has gone up 5 and inflation has simultaneously increased by 6 what would happen to your real income decreased by 1 O decreased by 11 increased by 1
![Output Income 1000 2000 3000 4000 5000 6000 7000 Consumption ent 3000 1000 2000 6000 7000 4000 5000 900 1700 2500 3300 4100 4900 5700 500 500 500 500 500 500 500 What is the equilibrium level of output income Gov Spending MOD 400 400 400 400 400 400](https://media.kunduz.com/media/sug-question-candidate/20231209035703290243-4426144.jpg?w=256)
Biology
The Living WorldOutput Income 1000 2000 3000 4000 5000 6000 7000 Consumption ent 3000 1000 2000 6000 7000 4000 5000 900 1700 2500 3300 4100 4900 5700 500 500 500 500 500 500 500 What is the equilibrium level of output income Gov Spending MOD 400 400 400 400 400 400
![m rket economic system an economy is largely dis embedded from political or social institutions the important consequence of the right of private property is that it investment innovation exchange maintenance of property and economic encourages growth penalty system is social disapproval individuals search for monetary gain is justified and further promoted Question 28 2 points Saved 4 Listen Keynesian Economics does NOT argue that the government has to balance its budget to minimize the crowding out effects an attempt by the economy as a whole to increase aggregate savings not only will not succeed but may lower aggregate output income and employment fiscal and monetary policies are necessary to stabilize an economy the State government which many see as a slow boring](https://media.kunduz.com/media/sug-question-candidate/20231209035525811425-4426144.jpg?w=256)
Biology
The Living Worldm rket economic system an economy is largely dis embedded from political or social institutions the important consequence of the right of private property is that it investment innovation exchange maintenance of property and economic encourages growth penalty system is social disapproval individuals search for monetary gain is justified and further promoted Question 28 2 points Saved 4 Listen Keynesian Economics does NOT argue that the government has to balance its budget to minimize the crowding out effects an attempt by the economy as a whole to increase aggregate savings not only will not succeed but may lower aggregate output income and employment fiscal and monetary policies are necessary to stabilize an economy the State government which many see as a slow boring
![put are at their lowest levels an expansion in the business cycle is occurring cyclical unemployment is occurring a trough in the business cycle is occurring a peak in the business cycle is occurring Question 26 2 points Saved 4 Listen Keynesian Economics does NOT argue that Big Government national treasury and the Big Bank central bank have prevented reoccurrence of a crisis like the Great Depression after WWII a capitalist economy is fundamentally stable and prone to full employment it is the unstable and volatile investment that primarily causes fluctuation in economy higher minimum ware and pore](https://media.kunduz.com/media/sug-question-candidate/20231209035510610309-4426144.jpg?w=256)
Biology
The Living Worldput are at their lowest levels an expansion in the business cycle is occurring cyclical unemployment is occurring a trough in the business cycle is occurring a peak in the business cycle is occurring Question 26 2 points Saved 4 Listen Keynesian Economics does NOT argue that Big Government national treasury and the Big Bank central bank have prevented reoccurrence of a crisis like the Great Depression after WWII a capitalist economy is fundamentally stable and prone to full employment it is the unstable and volatile investment that primarily causes fluctuation in economy higher minimum ware and pore
![What Items does the Consumer Price Index keep track of capital goods bought by companies consumer goods and services bought by country side consumers exports bought by foreigners consumer goods and services bought by urban consumers](https://media.kunduz.com/media/sug-question-candidate/20231209024054600501-4426144.jpg?w=256)
Biology
The Living WorldWhat Items does the Consumer Price Index keep track of capital goods bought by companies consumer goods and services bought by country side consumers exports bought by foreigners consumer goods and services bought by urban consumers
![When the unemployment rate equals the sum of frictional and structural unemployment the economy is operating at zero unemployment the economy is operating at its minimum output level cyclical unemployment is at its maximum value the economy is operating at the natural rate of unemployment](https://media.kunduz.com/media/sug-question-candidate/20231209023035281447-4426152.jpg?w=256)
Biology
The Living WorldWhen the unemployment rate equals the sum of frictional and structural unemployment the economy is operating at zero unemployment the economy is operating at its minimum output level cyclical unemployment is at its maximum value the economy is operating at the natural rate of unemployment
![During a recession both the equilibrium wage and the equilibrium level of employment are low Why Olower supply of workers higher demand for workers lower demand for workers higher supply of workers](https://media.kunduz.com/media/sug-question-candidate/20231209022914037061-4426144.jpg?w=256)
Biology
The Living WorldDuring a recession both the equilibrium wage and the equilibrium level of employment are low Why Olower supply of workers higher demand for workers lower demand for workers higher supply of workers
![Identify the cell cycle stage for each cell in the diagram Vy V K Answer Bank metaphase prophase interphase telophase anaphase](https://media.kunduz.com/media/sug-question-candidate/20231209015306177951-5870066.jpg?w=256)
Biology
The Living WorldIdentify the cell cycle stage for each cell in the diagram Vy V K Answer Bank metaphase prophase interphase telophase anaphase
![Identify each stage of M phase AAAA V V V V DOS Answer Bank VVK 3 8](https://media.kunduz.com/media/sug-question-candidate/20231209015346802214-5870066.jpg?w=256)
![The cell cycle is a repeating sequence of events that leads to the duplication and division of a cell Place the stages of the cell cycle in the order of their occurrence from the earliest stage of cell growth through the latest stage of cell division Earliest](https://media.kunduz.com/media/sug-question-candidate/20231209014906187427-5870066.jpg?w=256)
Biology
The Living WorldThe cell cycle is a repeating sequence of events that leads to the duplication and division of a cell Place the stages of the cell cycle in the order of their occurrence from the earliest stage of cell growth through the latest stage of cell division Earliest
![5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows](https://media.kunduz.com/media/sug-question-candidate/20231208013822435079-6098643.jpg?w=256)
Biology
The Living World5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows
![Predict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response](https://media.kunduz.com/media/sug-question-candidate/20231207045548104502-4144409.jpg?w=256)
Biology
The Living WorldPredict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response
![DNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5](https://media.kunduz.com/media/sug-question-candidate/20231205222809684968-4555708.jpg?w=256)
Biology
The Living WorldDNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5
![A bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population](https://media.kunduz.com/media/sug-question-candidate/20231205234647694042-5904656.jpg?w=256)
Biology
The Living WorldA bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population
![You are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an autosomal trait that shows a recessive expression pattern What is the frequency of the deleterious harmful allele in the population 2 20 80 4](https://media.kunduz.com/media/sug-question-candidate/20231205234557532139-5904656.jpg?w=256)
Biology
The Living WorldYou are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an autosomal trait that shows a recessive expression pattern What is the frequency of the deleterious harmful allele in the population 2 20 80 4
![In the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways the population is diploid the population is doubling in number](https://media.kunduz.com/media/sug-question-candidate/20231205234549195748-5904656.jpg?w=256)
Biology
The Living WorldIn the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways the population is diploid the population is doubling in number
![The tRNA nucleotide sequence that pairs with bases on the mRNA is called a n intron O exon O codon O initiation factor Q anticodon QUESTION 40 When a polypeptide is being assembled the bond that forms between a newly added amino acid and the previous amino acid in the chaim a bond O hydrogen O hydrophobic O terminal O phosphodiester](https://media.kunduz.com/media/sug-question-candidate/20231205193622937868-4348260.jpg?w=256)
Biology
The Living WorldThe tRNA nucleotide sequence that pairs with bases on the mRNA is called a n intron O exon O codon O initiation factor Q anticodon QUESTION 40 When a polypeptide is being assembled the bond that forms between a newly added amino acid and the previous amino acid in the chaim a bond O hydrogen O hydrophobic O terminal O phosphodiester
![An organism has been found to contain a defective form of photolyase What function might be impaired in this organism r Lengthening of the tips of chromosomes Repair of DNA damage caused by UV light Stabilization of single stranded DNA during DNA replication Recognition of damaged DNA by the UvrABC complex QUESTION 26 The sequence of nucleotides in a DNA molecule is called the O protein ribosomal translation genetic amino acid code](https://media.kunduz.com/media/sug-question-candidate/20231205193447463286-4348260.jpg?w=256)
Biology
The Living WorldAn organism has been found to contain a defective form of photolyase What function might be impaired in this organism r Lengthening of the tips of chromosomes Repair of DNA damage caused by UV light Stabilization of single stranded DNA during DNA replication Recognition of damaged DNA by the UvrABC complex QUESTION 26 The sequence of nucleotides in a DNA molecule is called the O protein ribosomal translation genetic amino acid code
![Plants are examples of heterotrophs True O False](https://media.kunduz.com/media/sug-question-candidate/20231205172727052908-4553535.jpg?w=256)
![Can you make two questions about patents](https://media.kunduz.com/media/sug-question-candidate/20231205151600207977-4426144.jpg?w=256)
![Can you make two questions about patents](https://media.kunduz.com/media/sug-question-candidate/20231205151550409408-4426144.jpg?w=256)
![Which term describes an organism that cannot survive in the presence of oxygen obligate aerobe O obligate anaerobe O pathogen facultative aerobe 1F](https://media.kunduz.com/media/sug-question-candidate/20231205142733177643-4553535.jpg?w=256)
Biology
The Living WorldWhich term describes an organism that cannot survive in the presence of oxygen obligate aerobe O obligate anaerobe O pathogen facultative aerobe 1F
![Which statement is true about all members of Domain Eubacteria and Domain Archaea 1 point O They are multicellular organisms prokaryotes and contain membrane bound organelles They are multicellular organisms eukaryotes and lack membrane bound organelles O They are single celled organisms prokaryotes and contain membrane bound organelles They are single celled organisms prokaryotes and lack membrane bound organelles](https://media.kunduz.com/media/sug-question-candidate/20231205142659012361-4553535.jpg?w=256)
Biology
The Living WorldWhich statement is true about all members of Domain Eubacteria and Domain Archaea 1 point O They are multicellular organisms prokaryotes and contain membrane bound organelles They are multicellular organisms eukaryotes and lack membrane bound organelles O They are single celled organisms prokaryotes and contain membrane bound organelles They are single celled organisms prokaryotes and lack membrane bound organelles
![Which statement s is are true about prokaryotes The total mass of prokaryotes exceeds that of animals and possible all plant life on Earth More than 100 trillion bacteria live on and within our bodies 1 point They live in a variety of environments including on the surface of other organisms in water and soil deep within Earth in boiling hot springs and in ice All of the above](https://media.kunduz.com/media/sug-question-candidate/20231205142640197435-4553535.jpg?w=256)
Biology
The Living WorldWhich statement s is are true about prokaryotes The total mass of prokaryotes exceeds that of animals and possible all plant life on Earth More than 100 trillion bacteria live on and within our bodies 1 point They live in a variety of environments including on the surface of other organisms in water and soil deep within Earth in boiling hot springs and in ice All of the above
![Which animal is classified in the Arthropoda phylum pinworms earthworms snails insects](https://media.kunduz.com/media/sug-question-candidate/20231205142622523647-4553535.jpg?w=256)
Biology
The Living WorldWhich animal is classified in the Arthropoda phylum pinworms earthworms snails insects
![Which term describes a form of asexual reproduction that involves the division of one parent cell into two genetically identical daughter cells Otransformation conjugation binary fission fermentation](https://media.kunduz.com/media/sug-question-candidate/20231205142546384950-4553535.jpg?w=256)
Biology
The Living WorldWhich term describes a form of asexual reproduction that involves the division of one parent cell into two genetically identical daughter cells Otransformation conjugation binary fission fermentation
![Which term describes a corkscrew shaped bacterial cell O spirillum O pathogen O bacillus O COCCUS](https://media.kunduz.com/media/sug-question-candidate/20231205142510175297-4553535.jpg?w=256)
Biology
The Living WorldWhich term describes a corkscrew shaped bacterial cell O spirillum O pathogen O bacillus O COCCUS
![What type of cell contains half the usual complement of chromosomes zygote O haploid O diploid all of the above](https://media.kunduz.com/media/sug-question-candidate/20231205142448555967-4553535.jpg?w=256)
Biology
The Living WorldWhat type of cell contains half the usual complement of chromosomes zygote O haploid O diploid all of the above
![Which statement is true about the domains of living things Kingdom Bacteria and Kingdom Archaea are in the same domain Domain Eucaryotes includes only Kingdom Protista Domain Bacteria includes Kingdom Archaea and Kingdom Protista Four kingdoms are classified into the Domain Eukaryote](https://media.kunduz.com/media/sug-question-candidate/20231205142430755457-4553535.jpg?w=256)
Biology
The Living WorldWhich statement is true about the domains of living things Kingdom Bacteria and Kingdom Archaea are in the same domain Domain Eucaryotes includes only Kingdom Protista Domain Bacteria includes Kingdom Archaea and Kingdom Protista Four kingdoms are classified into the Domain Eukaryote
![What is the highest taxonomic level O domain O family O phylum O genus](https://media.kunduz.com/media/sug-question-candidate/20231205142333937522-4553535.jpg?w=256)
![Which term describes a single celled organism that contains membrane bound organelles O autotroph O eukaryote heterotroph Oprokaryote](https://media.kunduz.com/media/sug-question-candidate/20231205142314052064-4553535.jpg?w=256)
Biology
The Living WorldWhich term describes a single celled organism that contains membrane bound organelles O autotroph O eukaryote heterotroph Oprokaryote
![In Linnaeus s binomial naming system the second name is always what O the specific name O the genus name the clade name the kingdom name](https://media.kunduz.com/media/sug-question-candidate/20231205142256970775-4553535.jpg?w=256)
Biology
The Living WorldIn Linnaeus s binomial naming system the second name is always what O the specific name O the genus name the clade name the kingdom name
![Which of the following is an example of an autotroph tree O dog bird elephant](https://media.kunduz.com/media/sug-question-candidate/20231205142221602906-4553535.jpg?w=256)
Biology
The Living WorldWhich of the following is an example of an autotroph tree O dog bird elephant
![How does loss of biodiversity affect humans It threatens our food supply O It has a significant economic impact on tourism and forestry O It eliminates sources of natural medicines O all of the above](https://media.kunduz.com/media/sug-question-candidate/20231205142158337679-4553535.jpg?w=256)
Biology
The Living WorldHow does loss of biodiversity affect humans It threatens our food supply O It has a significant economic impact on tourism and forestry O It eliminates sources of natural medicines O all of the above
![1 Create a brochure over an infectious disease that can be distributed in a healthcare facility The brochure should be professional and informative You may choose your own microbe After signing into Canva you can search brochure in the search bar for options You may also create the artifact using a blank template Be sure to include pictures or graphics where applicable nclude the following in your brochure The infectious disease and the causative agent the microbe Mode of transmission Signs Symptoms](https://media.kunduz.com/media/sug-question-candidate/20231204223346824616-4724274.jpg?w=256)
Biology
The Living World1 Create a brochure over an infectious disease that can be distributed in a healthcare facility The brochure should be professional and informative You may choose your own microbe After signing into Canva you can search brochure in the search bar for options You may also create the artifact using a blank template Be sure to include pictures or graphics where applicable nclude the following in your brochure The infectious disease and the causative agent the microbe Mode of transmission Signs Symptoms
![on 1 A an occurs when the receiving team successfully puts the ball away against the serving team or when the serving team commits an unforced error and the receiving team thus gains the right to serve point O attack service error Points 2 O side out](https://media.kunduz.com/media/sug-question-candidate/20231204180327084527-6175470.jpg?w=256)
Biology
The Living Worldon 1 A an occurs when the receiving team successfully puts the ball away against the serving team or when the serving team commits an unforced error and the receiving team thus gains the right to serve point O attack service error Points 2 O side out
![Fruits have contributed to the success of angiosperms by nourishing the plants that make them facilitating the dispersal of seeds attracting insects to the pollen inside producing sperm and egg inside a protective coat producing trippid cells via double fertilization](https://media.kunduz.com/media/sug-question-candidate/20231204164239762519-5904656.jpg?w=256)
Biology
The Living WorldFruits have contributed to the success of angiosperms by nourishing the plants that make them facilitating the dispersal of seeds attracting insects to the pollen inside producing sperm and egg inside a protective coat producing trippid cells via double fertilization
![You have now learned about pollination and fertilization in the flowering plants It is important to remember what these two processes are and how they occur Which of the following is the correct order of events sperm cells form in anthers pollination occurs the pollen tube reaches the ovule the egg is fertilized the stigma is fertilized the sperm cells develop the pollen tube reaches the ovule the sperm cells reach the egg the stigma is pollinated the pollen germinates double fertilization occurs the seed begins to develop pollen is produced the pollen is distributed to the stigma the pollen tube grows to the ovule the sperm cells are produced](https://media.kunduz.com/media/sug-question-candidate/20231204164249830002-5904656.jpg?w=256)
Biology
The Living WorldYou have now learned about pollination and fertilization in the flowering plants It is important to remember what these two processes are and how they occur Which of the following is the correct order of events sperm cells form in anthers pollination occurs the pollen tube reaches the ovule the egg is fertilized the stigma is fertilized the sperm cells develop the pollen tube reaches the ovule the sperm cells reach the egg the stigma is pollinated the pollen germinates double fertilization occurs the seed begins to develop pollen is produced the pollen is distributed to the stigma the pollen tube grows to the ovule the sperm cells are produced
![The seeds of a flowering plant consist of a n Select Select tissue endosperm The seed coat is Select em](https://media.kunduz.com/media/sug-question-candidate/20231204164218795027-5904656.jpg?w=256)
Biology
The Living WorldThe seeds of a flowering plant consist of a n Select Select tissue endosperm The seed coat is Select em
![You find a plant you have never seen before and notice the flowers are relatively small lack any odor and are relatively colorless The flower is most likely pollinated by flies hummingbirds bees the wind](https://media.kunduz.com/media/sug-question-candidate/20231204164156263453-5904656.jpg?w=256)
Biology
The Living WorldYou find a plant you have never seen before and notice the flowers are relatively small lack any odor and are relatively colorless The flower is most likely pollinated by flies hummingbirds bees the wind