Biology Questions
The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.
![Question 37 Who is responsible for spreading Spanish flu across Europe O French Soldiers African Americans O British soldiers O American forces personnel](https://media.kunduz.com/media/sug-question-candidate/20230809134635237539-5816702.jpg?w=256)
Biology
Ecology - GeneralQuestion 37 Who is responsible for spreading Spanish flu across Europe O French Soldiers African Americans O British soldiers O American forces personnel
![Question 44 Identify the country where the Boxer Rebellion unfolded O Japan Points 1 O England O Nicaragua O China](https://media.kunduz.com/media/sug-question-candidate/20230809134918064049-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsQuestion 44 Identify the country where the Boxer Rebellion unfolded O Japan Points 1 O England O Nicaragua O China
![uestion 38 Points 1 he included the countries of France Britain Russia Serbia and eventually the USA Central Powers O Allied Powers National Defense Committee O None of these choices](https://media.kunduz.com/media/sug-question-candidate/20230809134647597531-5816702.jpg?w=256)
Biology
Ecology - Ecosystemsuestion 38 Points 1 he included the countries of France Britain Russia Serbia and eventually the USA Central Powers O Allied Powers National Defense Committee O None of these choices
![I swear to the Lord I still can t see Why Democracy means Everybody but me Using the information you learned in the lesson which of the following writer matches the writing style above O Langston Hughes O Countee Cullen Zora Neale Hurston](https://media.kunduz.com/media/sug-question-candidate/20230809130449666177-5816702.jpg?w=256)
Biology
Ecology - GeneralI swear to the Lord I still can t see Why Democracy means Everybody but me Using the information you learned in the lesson which of the following writer matches the writing style above O Langston Hughes O Countee Cullen Zora Neale Hurston
![Choose the correct answer The movement aimed at returning control of the government to the people restoring economic opportunities and correcting injustices in American life was called Prohibition the Era of Good Feelings O the Progressive Movement the Glorious Revolution Complete Later Complete](https://media.kunduz.com/media/sug-question-candidate/20230809130359227255-5816702.jpg?w=256)
Biology
Ecology - GeneralChoose the correct answer The movement aimed at returning control of the government to the people restoring economic opportunities and correcting injustices in American life was called Prohibition the Era of Good Feelings O the Progressive Movement the Glorious Revolution Complete Later Complete
![Choose the correct answer is a popular music style of the early 1900s that originated among African Americans in New Orleans in the late 19th century and is characterized by syncopated rhythms and improvisation O Scat O Blues O Jazz O Bluegrass](https://media.kunduz.com/media/sug-question-candidate/20230809130418547094-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsChoose the correct answer is a popular music style of the early 1900s that originated among African Americans in New Orleans in the late 19th century and is characterized by syncopated rhythms and improvisation O Scat O Blues O Jazz O Bluegrass
![Points 1 Effort to improve efficiency in the workplace by applying scientific principles to make tasks simpler and easier is called O Interchangeable Parts O Scentiffic Management O Scientific Method Complette Latter](https://media.kunduz.com/media/sug-question-candidate/20230809130336037856-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsPoints 1 Effort to improve efficiency in the workplace by applying scientific principles to make tasks simpler and easier is called O Interchangeable Parts O Scentiffic Management O Scientific Method Complette Latter
![Question 30 Points 2 There are three barriers to entry for utility companies Which of the following explanations does NOT belong New utility companies are discouraged from competing with established utility companies because legislation strictly discourages competition New utility companies are discouraged from competing because one of the largest barriers to entry for utility companies is the high initial investment New utility companies are discouraged from competing with established utility companies because of the high fines associated with pollution New utility companies are discouraged from competing because established utility companies control most of the raw materials needed to operate a power plant Complete Later Complete 2](https://media.kunduz.com/media/sug-question-candidate/20230809130303677626-5816702.jpg?w=256)
Biology
Ecology - GeneralQuestion 30 Points 2 There are three barriers to entry for utility companies Which of the following explanations does NOT belong New utility companies are discouraged from competing with established utility companies because legislation strictly discourages competition New utility companies are discouraged from competing because one of the largest barriers to entry for utility companies is the high initial investment New utility companies are discouraged from competing with established utility companies because of the high fines associated with pollution New utility companies are discouraged from competing because established utility companies control most of the raw materials needed to operate a power plant Complete Later Complete 2
![Protecting social welfare Goals of the Progressive Movement Improving efficiency Which of the following BEST completes the diagram Combating racial discrimination and creating economic reform O Creating economic reform and encouraging public spending Promoting moral reform and creating economi](https://media.kunduz.com/media/sug-question-candidate/20230809130320418236-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsProtecting social welfare Goals of the Progressive Movement Improving efficiency Which of the following BEST completes the diagram Combating racial discrimination and creating economic reform O Creating economic reform and encouraging public spending Promoting moral reform and creating economi
![Which ope of monopoly is thought to be the most efficient](https://media.kunduz.com/media/sug-question-candidate/20230809130141223153-5816702.jpg?w=256)
![Carefully read the following quotation The wisest among my race understand that the agitation of questions of social equality is the extremest folly Based on the quotation the lesson and your own knowledge who do you think spoke these words W E B Du Bois O Booker T Washington O Harriet Tubman Ida B Wells Complete Later Complete](https://media.kunduz.com/media/sug-question-candidate/20230809130121943173-5816702.jpg?w=256)
Biology
Ecology - EcosystemsCarefully read the following quotation The wisest among my race understand that the agitation of questions of social equality is the extremest folly Based on the quotation the lesson and your own knowledge who do you think spoke these words W E B Du Bois O Booker T Washington O Harriet Tubman Ida B Wells Complete Later Complete
![Question 20 Points 2 The main reason for the depressed state of agriculture in the United States in the 1920 s was O Rapid industrialization O Availability of cheap land for farming O Completed interstate highway system Relaxation of immigration laws Complete Later Complete](https://media.kunduz.com/media/sug-question-candidate/20230808233904084717-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsQuestion 20 Points 2 The main reason for the depressed state of agriculture in the United States in the 1920 s was O Rapid industrialization O Availability of cheap land for farming O Completed interstate highway system Relaxation of immigration laws Complete Later Complete
![Question 25 Points 2 I helped bring legal challenges to segregation and lobbied hard for African Americans full civil liberties I considered racial discrimination a problem that could not be ignored I established what is now know as the NAACP Who am I Ida B Wells O Booker T Washington O W E B Du Bois O Mia Bay](https://media.kunduz.com/media/sug-question-candidate/20230808234008585164-5816702.jpg?w=256)
Biology
Ecology - EcosystemsQuestion 25 Points 2 I helped bring legal challenges to segregation and lobbied hard for African Americans full civil liberties I considered racial discrimination a problem that could not be ignored I established what is now know as the NAACP Who am I Ida B Wells O Booker T Washington O W E B Du Bois O Mia Bay
![Read the following passage Bitter complaints have come in from countless places citing the provocative behavior of Jews a certain amount of conspiratorial planning was involved To prevent vigorous defensive action by the Aryan people we have no choice but to contain the problem through legislative measures Adolph Hitler Hitler s words were spoken before the Reichstag in Nuremberg before the Nazis adopted the Nuremberg Laws which was a set of laws that systemized anti Semitism These types of laws may be compared to in the United States O Dred Scott laws O Jim Crow laws the Fugitive Slave Act O the platform of the Ku Klux Klan 2 25 33 37](https://media.kunduz.com/media/sug-question-candidate/20230808234021004270-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsRead the following passage Bitter complaints have come in from countless places citing the provocative behavior of Jews a certain amount of conspiratorial planning was involved To prevent vigorous defensive action by the Aryan people we have no choice but to contain the problem through legislative measures Adolph Hitler Hitler s words were spoken before the Reichstag in Nuremberg before the Nazis adopted the Nuremberg Laws which was a set of laws that systemized anti Semitism These types of laws may be compared to in the United States O Dred Scott laws O Jim Crow laws the Fugitive Slave Act O the platform of the Ku Klux Klan 2 25 33 37
![Study the following table 1910 After 1900 1881 1924 1882 Year O A C D B O C D B A OD B A C Choice OB C D A Which of the following answer choices shows the correct matching order of the Choice column from top to bottom Event A Congress passed the Chinese Exclusion Act B Marked the high point of Italian immigration to the United States C Many Danish immigrants were Mormon converts who moved to Utah D Two million Jews fled the pogroms organized attacks of the Russian Empire 17 21 25 29 33 1 22 26 30 34](https://media.kunduz.com/media/sug-question-candidate/20230808233942506570-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsStudy the following table 1910 After 1900 1881 1924 1882 Year O A C D B O C D B A OD B A C Choice OB C D A Which of the following answer choices shows the correct matching order of the Choice column from top to bottom Event A Congress passed the Chinese Exclusion Act B Marked the high point of Italian immigration to the United States C Many Danish immigrants were Mormon converts who moved to Utah D Two million Jews fled the pogroms organized attacks of the Russian Empire 17 21 25 29 33 1 22 26 30 34
![Question 24 The vast majority of the immigrants from Lebanon and Syria were O Jews Points 1 Muslims Christians O Druze](https://media.kunduz.com/media/sug-question-candidate/20230808233958107235-5816702.jpg?w=256)
Biology
BiomoleculesQuestion 24 The vast majority of the immigrants from Lebanon and Syria were O Jews Points 1 Muslims Christians O Druze
![Question 19 Points 2 One of the reasons for the formation of nativist groups was they feared job loss because immigrants might work for lower wages Opublic and private transportation was limited O the country s transformation from an agrarian to an urban country because immigrants lead to the creation of a new social class](https://media.kunduz.com/media/sug-question-candidate/20230808233852863781-5816702.jpg?w=256)
Biology
Ecology - EcosystemsQuestion 19 Points 2 One of the reasons for the formation of nativist groups was they feared job loss because immigrants might work for lower wages Opublic and private transportation was limited O the country s transformation from an agrarian to an urban country because immigrants lead to the creation of a new social class
![Choose the correct answer The development of wide scale industries in a country or region is called O Urbanization O Industrialization O Rural flight O Development](https://media.kunduz.com/media/sug-question-candidate/20230808233916564581-5816702.jpg?w=256)
Biology
BiomoleculesChoose the correct answer The development of wide scale industries in a country or region is called O Urbanization O Industrialization O Rural flight O Development
![Read the following and answer the question Immigration patterns of the 1930s were dominated by the Great Depression which hit the U S hard and lasted over ten years In the final prosperous year 1929 there were 279 678 immigrants recorded but in 1933 only 23 068 came to the U S In the early 1930s more people emigrated from the United States than immigrated to it The U S government sponsored a Mexican Repatriation program which was intended to encourage people to voluntarily move to Mexico However thousands were deported against their will Altogether about 400 000 Mexicans were repatriated What event led to the repatriation of close to half a million Mexican immigrants O The United State Right to Work Act of 1930 O World War II The Great Depression The Immigration Act of 1924](https://media.kunduz.com/media/sug-question-candidate/20230808233930926065-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsRead the following and answer the question Immigration patterns of the 1930s were dominated by the Great Depression which hit the U S hard and lasted over ten years In the final prosperous year 1929 there were 279 678 immigrants recorded but in 1933 only 23 068 came to the U S In the early 1930s more people emigrated from the United States than immigrated to it The U S government sponsored a Mexican Repatriation program which was intended to encourage people to voluntarily move to Mexico However thousands were deported against their will Altogether about 400 000 Mexicans were repatriated What event led to the repatriation of close to half a million Mexican immigrants O The United State Right to Work Act of 1930 O World War II The Great Depression The Immigration Act of 1924
![Question 17 Points 3 Which production system is mentioned in this graphical representation Production of large number of items The assembly line was then devised by the manufacturers O Division of labor All manufactured parts were assembled in one place O Primitive communism O Mass production Division of labor use of interchgeable parts and assembly line played a vital role Feudal mode of production](https://media.kunduz.com/media/sug-question-candidate/20230808233815348504-5816702.jpg?w=256)
Biology
Anatomy of Flowering PlantsQuestion 17 Points 3 Which production system is mentioned in this graphical representation Production of large number of items The assembly line was then devised by the manufacturers O Division of labor All manufactured parts were assembled in one place O Primitive communism O Mass production Division of labor use of interchgeable parts and assembly line played a vital role Feudal mode of production
![Question 18 Points 1 Who is considered the founder of modern economics The Physiocrats Thomas Malthus David Ricardo O Adam Smith](https://media.kunduz.com/media/sug-question-candidate/20230808233840945863-5816702.jpg?w=256)
Biology
BiomoleculesQuestion 18 Points 1 Who is considered the founder of modern economics The Physiocrats Thomas Malthus David Ricardo O Adam Smith
![Offend fork Efst k Alla fing st](https://media.kunduz.com/media/sug-question-candidate/20230808165752908909-5819704.jpg?w=256)
![In his essay Common Sense Paine fears that they might be in danger of being rule by a ruffian in case they don t act then Whom does the word ruffian refer to O William Henry William Blake William the Conqueror William Wordsworth](https://media.kunduz.com/media/sug-question-candidate/20230808140915244162-5819223.jpg?w=256)
Biology
The Living WorldIn his essay Common Sense Paine fears that they might be in danger of being rule by a ruffian in case they don t act then Whom does the word ruffian refer to O William Henry William Blake William the Conqueror William Wordsworth
![homologous chromosome pair maternal a paternal 1 DNA rep 2 STZAAN 3 Question 2 When does the transition from stage 2 to stage 3 occur A Mitosis B Meiosis I C Meiosis II Question 3 At stages 2 and 3 what alleles will be present on the left and right members of the blue sister chromatid pair A A and A B a and a C A and a](https://media.kunduz.com/media/sug-question-candidate/20230808062057862802-3636637.jpg?w=256)
Biology
Cell Cycle and Cell Divisionhomologous chromosome pair maternal a paternal 1 DNA rep 2 STZAAN 3 Question 2 When does the transition from stage 2 to stage 3 occur A Mitosis B Meiosis I C Meiosis II Question 3 At stages 2 and 3 what alleles will be present on the left and right members of the blue sister chromatid pair A A and A B a and a C A and a
![Question 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The speciation of squirrel populations separated by a geographic barrier C The extinction of a species of eucalyptus tree due to forest fires D Slow changes to a habitat that cause divergence in forest populations SUBMIT](https://media.kunduz.com/media/sug-question-candidate/20230808025214924778-5807360.jpg?w=256)
Biology
Ecology - Biodiversity & ConservationQuestion 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The speciation of squirrel populations separated by a geographic barrier C The extinction of a species of eucalyptus tree due to forest fires D Slow changes to a habitat that cause divergence in forest populations SUBMIT
![4 Examine the following sequence Note that only one of the complementary strands is shown You do not have to write in the complementary strand I 5 atgcacgcag ttttacttgc ttcttcaaga gettatggag ccaagaaaaa gtcacttcac cctactggga aaacacaaaa gctccttaaa gtaccgaagg www](https://media.kunduz.com/media/sug-question-candidate/20230807040915563052-4890388.jpg?w=256)
Biology
Biotechnology & its Applications4 Examine the following sequence Note that only one of the complementary strands is shown You do not have to write in the complementary strand I 5 atgcacgcag ttttacttgc ttcttcaaga gettatggag ccaagaaaaa gtcacttcac cctactggga aaacacaaaa gctccttaaa gtaccgaagg www
![d Using the previously made stocks on the previous page of 5 00M Tris 3 00M MgCl and 0 500M DTT how would you make 50 0mLs of 10x Ligation buffer that has the following concentrations of chemicals 10g 100L 5 00mM Tris pH 7 6 100 0mM MgCl 5 00mM DTT Show math 3 0 005 mol ML x 1000mL 5 00 mol 1 x 50 50ml Explain in words how would you make 50 0mLs of 10x Ligation buffer on the previous page 1](https://media.kunduz.com/media/sug-question-candidate/20230805210955479513-4702656.jpg?w=256)
Biology
Cell: The Unit of Lifed Using the previously made stocks on the previous page of 5 00M Tris 3 00M MgCl and 0 500M DTT how would you make 50 0mLs of 10x Ligation buffer that has the following concentrations of chemicals 10g 100L 5 00mM Tris pH 7 6 100 0mM MgCl 5 00mM DTT Show math 3 0 005 mol ML x 1000mL 5 00 mol 1 x 50 50ml Explain in words how would you make 50 0mLs of 10x Ligation buffer on the previous page 1
![a If positive control is homozygous recessive would you be able to determine if restriction digestion was effective b Forward and reverse primers complementary would anneal rather than anneal to the DNA target c What are the major components of PCR Dilution questions serial dilutions percent solutions w v v v molarity a Prepare 1L DMEM 10 FBS 1 Glutamine 1 Pen strep b Prepare 200mL of 0 1 M CaCl from stock of 10M CaCl C](https://media.kunduz.com/media/sug-question-candidate/20230805204102881131-4702656.jpg?w=256)
Biology
Biotechnology & its Applicationsa If positive control is homozygous recessive would you be able to determine if restriction digestion was effective b Forward and reverse primers complementary would anneal rather than anneal to the DNA target c What are the major components of PCR Dilution questions serial dilutions percent solutions w v v v molarity a Prepare 1L DMEM 10 FBS 1 Glutamine 1 Pen strep b Prepare 200mL of 0 1 M CaCl from stock of 10M CaCl C
![5 4 points You have 5 x107 cells mL in a volume of 2 mLs a How many cell culture flasks can you seed at a density of 1 x 105 cells mL if each flasks will have a final volume of 5mL Answer Show calculation b How many mL of the resuspended cells will you seed into each flask Answer](https://media.kunduz.com/media/sug-question-candidate/20230805203744024877-4702656.jpg?w=256)
Biology
Biotechnology: Principles and Processes5 4 points You have 5 x107 cells mL in a volume of 2 mLs a How many cell culture flasks can you seed at a density of 1 x 105 cells mL if each flasks will have a final volume of 5mL Answer Show calculation b How many mL of the resuspended cells will you seed into each flask Answer
![8 A In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 plate LB LB AMP LB AMP ARA Explanation Plasmid Growth 100 white colonies 100 white colonies Plasmid Growth No growth No growth](https://media.kunduz.com/media/sug-question-candidate/20230805203924206517-4702656.jpg?w=256)
Biology
Anatomy of Flowering Plants8 A In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 plate LB LB AMP LB AMP ARA Explanation Plasmid Growth 100 white colonies 100 white colonies Plasmid Growth No growth No growth
![9 Why are positive and negative controls important in the western blot explain how those results can affect the Ponceau stain and the Western blot data When and why would you use western blot versus the ELISA](https://media.kunduz.com/media/sug-question-candidate/20230805204005042619-4702656.jpg?w=256)
Biology
Animal Kingdom9 Why are positive and negative controls important in the western blot explain how those results can affect the Ponceau stain and the Western blot data When and why would you use western blot versus the ELISA
![B In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 Plate B LB AMP B AMP ARA Explanation Plasmid Growth No growth No growth Plasmid Growth No growth No growth](https://media.kunduz.com/media/sug-question-candidate/20230805203940062405-4702656.jpg?w=256)
Biology
Anatomy of Flowering PlantsB In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 Plate B LB AMP B AMP ARA Explanation Plasmid Growth No growth No growth Plasmid Growth No growth No growth
![11 What was the purpose of SDS and NaOH in the plasmid isolation proctocol Why was ethanol Isopropyl alcohol used in the isolation protocol For the plasmid isolation protocol why would you want to run the gel longer What was the purpose of incubating the restriction digestion at 37C and what were the restriction enzymes used What are the four common steps of plasmid isolation Growth lysis separation precipitation](https://media.kunduz.com/media/sug-question-candidate/20230805204043380894-4702656.jpg?w=256)
Biology
Animal Kingdom11 What was the purpose of SDS and NaOH in the plasmid isolation proctocol Why was ethanol Isopropyl alcohol used in the isolation protocol For the plasmid isolation protocol why would you want to run the gel longer What was the purpose of incubating the restriction digestion at 37C and what were the restriction enzymes used What are the four common steps of plasmid isolation Growth lysis separation precipitation
![10 Why do some Bacteria stain gram positive versus gram negative What structural components are different in bacteria that result in different colored bacteria in the gram stain When and why do you flame the loop in the isolation streak plate w](https://media.kunduz.com/media/sug-question-candidate/20230805204029543774-4702656.jpg?w=256)
Biology
Animal Kingdom10 Why do some Bacteria stain gram positive versus gram negative What structural components are different in bacteria that result in different colored bacteria in the gram stain When and why do you flame the loop in the isolation streak plate w
![6 2 points A procedure calls for 10ng of stock solution is 1 g DNA L How much stock do you need if your reaction mixture will be a total of 200 Ls Give answer in Ls Answer Show calculation 100 th picture for the](https://media.kunduz.com/media/sug-question-candidate/20230805203806104214-4702656.jpg?w=256)
Biology
Biotechnology: Principles and Processes6 2 points A procedure calls for 10ng of stock solution is 1 g DNA L How much stock do you need if your reaction mixture will be a total of 200 Ls Give answer in Ls Answer Show calculation 100 th picture for the
![cells mL You dilute the broth by removing 1mL and adding 4mL of sterile medium to give you dilution tube 1 of bacterial cells You remove 1mL from this first dilution tube and add 9mL of sterile medium to give dilution tube 2 You remove 0 5mL from this second dilution tube and add 9 5mL of sterile medium to give dilution tube 3 Diagram what you performed in the dilutions State each dilution in terms of 1 relative to the previous tube dilution tube 1 Math dilution tube 2 Math dilution tube 3 Math State the overall dilution of tube 3 from the original broth What is the concentration of the bacterial cells in each of the three dilution tubes once the dilution is performed tube 1 Math](https://media.kunduz.com/media/sug-question-candidate/20230805050530741447-4702656.jpg?w=256)
Biology
Biotechnology & its Applicationscells mL You dilute the broth by removing 1mL and adding 4mL of sterile medium to give you dilution tube 1 of bacterial cells You remove 1mL from this first dilution tube and add 9mL of sterile medium to give dilution tube 2 You remove 0 5mL from this second dilution tube and add 9 5mL of sterile medium to give dilution tube 3 Diagram what you performed in the dilutions State each dilution in terms of 1 relative to the previous tube dilution tube 1 Math dilution tube 2 Math dilution tube 3 Math State the overall dilution of tube 3 from the original broth What is the concentration of the bacterial cells in each of the three dilution tubes once the dilution is performed tube 1 Math
![b How would you make 500 0mLs of 3 00M MgCl mw 95 21 g mol Explain in words 1](https://media.kunduz.com/media/sug-question-candidate/20230805050640463671-4702656.jpg?w=256)
Biology
Ecology - Generalb How would you make 500 0mLs of 3 00M MgCl mw 95 21 g mol Explain in words 1
![Order the steps in breaking down a fatty acid 3 poir Dragged and dropped options will be automatically saved For keyboard navigation SHOW MOR III III III E Linkage to carnitine Fatty acid activation Citric acid cycle Beta oxidation](https://media.kunduz.com/media/sug-question-candidate/20230804205251331668-5777534.jpg?w=256)
Biology
Cell Cycle and Cell DivisionOrder the steps in breaking down a fatty acid 3 poir Dragged and dropped options will be automatically saved For keyboard navigation SHOW MOR III III III E Linkage to carnitine Fatty acid activation Citric acid cycle Beta oxidation
![The degradation of amino acids fatty acids and glucose all require the use of this same pathway Selected answer will be automatically saved For keyboard navigation press up down arrow keys to select an answer a b C d citric acid cycle glycolysis urea cycle PDH complex](https://media.kunduz.com/media/sug-question-candidate/20230804202521811462-5777534.jpg?w=256)
Biology
Cell Cycle and Cell DivisionThe degradation of amino acids fatty acids and glucose all require the use of this same pathway Selected answer will be automatically saved For keyboard navigation press up down arrow keys to select an answer a b C d citric acid cycle glycolysis urea cycle PDH complex
![What actually dictates the 5 3 direction of DNA replication O Okazaki fragments are not sterically hindered by 2 OH found in ribonucleotides making the 5 to 3 synthesis possible on both strands O What actually dictates the 5 3 direction of DNA replication The direction of polymerization is determined by primase not the nucleotide structure The triphosphate on 5 OH undergoes a nucleophilic attack by Mg2 in DNA polymerase The nucleophilic attack of the 3 hydroxyl group on the 5 phosphate group allows energy to be obtained from hydrolysis of pyrophosphate on the 5 end](https://media.kunduz.com/media/sug-question-candidate/20230804174137400208-4123275.jpg?w=256)
Biology
Molecular Basis of InheritanceWhat actually dictates the 5 3 direction of DNA replication O Okazaki fragments are not sterically hindered by 2 OH found in ribonucleotides making the 5 to 3 synthesis possible on both strands O What actually dictates the 5 3 direction of DNA replication The direction of polymerization is determined by primase not the nucleotide structure The triphosphate on 5 OH undergoes a nucleophilic attack by Mg2 in DNA polymerase The nucleophilic attack of the 3 hydroxyl group on the 5 phosphate group allows energy to be obtained from hydrolysis of pyrophosphate on the 5 end
![Choose the enzyme that synthesizes an RNA strand consisting of 10 nucleotides that is complementary to one of the template DNA strands endonuclease primase topoisomerase O helicase O polymerase](https://media.kunduz.com/media/sug-question-candidate/20230804171748949129-4123275.jpg?w=256)
Biology
Cell Cycle and Cell DivisionChoose the enzyme that synthesizes an RNA strand consisting of 10 nucleotides that is complementary to one of the template DNA strands endonuclease primase topoisomerase O helicase O polymerase
![Question 1 of 10 Which sentence describes an example of a spontaneous mutation A Radiation causes chemical bonds to form between cytosines O B Compounds insert themselves into the double helix OC RNA polymerase cannot read a bent DNA strand and adds the wrong RNA nucleotide D An incorrect nucleotide is added during the process of DNA replication SUBMIT](https://media.kunduz.com/media/sug-question-candidate/20230804153206547272-5811215.jpg?w=256)
Biology
BiomoleculesQuestion 1 of 10 Which sentence describes an example of a spontaneous mutation A Radiation causes chemical bonds to form between cytosines O B Compounds insert themselves into the double helix OC RNA polymerase cannot read a bent DNA strand and adds the wrong RNA nucleotide D An incorrect nucleotide is added during the process of DNA replication SUBMIT
![5 Calculate the nucleic acid concentration in g mL from the following information 4pts DNA A reading at 260 nm 0 35 a b C d RNA A reading at 260 nm 0 5 DNA A reading at 260 nm from a 1 100 dilution 0 12 RNA A reading at 260 nm from a 1 200 dilution 0 42](https://media.kunduz.com/media/sug-question-candidate/20230804054931485556-4890388.jpg?w=256)
Biology
The Living World5 Calculate the nucleic acid concentration in g mL from the following information 4pts DNA A reading at 260 nm 0 35 a b C d RNA A reading at 260 nm 0 5 DNA A reading at 260 nm from a 1 100 dilution 0 12 RNA A reading at 260 nm from a 1 200 dilution 0 42
![dicate which lymphocyte population you would expect to proliferate in each case Scenario I Ecenario II You decide to co culture lymphocytes from the strains listed in the table in order to observe the mixed lymphocyte reaction MLR In each case indicate which lymphocyte population bath neither population 1 or population 2 you would expect to proliferate 6pts Remember in a MLR T cells are responding reacting with MHC hop botype that is not their own The MHC is the antigen in this assay In MLR Tucells proliferate Mice Strains Population 1 Mouse A H 2 Mouse A H 2 Mouse A H 2 C57BL 6 H 2 Mouse A CBA H 2 Mouse B CBAx C57BL 6 offspring 4 2 Mouse AxB Population 2 Mouse B H 2 Mouse A H 2 mito mycin C treated killed cant proliferate Mouse B H 2 mitomycin C treated killed cant proliferate AxB offspring H 2 Mouse B H 2 Proliferation 48 8 IV a both b population 1](https://media.kunduz.com/media/sug-question-candidate/20230803014659489806-4322992.jpg?w=256)
Biology
Ecology - Ecosystemsdicate which lymphocyte population you would expect to proliferate in each case Scenario I Ecenario II You decide to co culture lymphocytes from the strains listed in the table in order to observe the mixed lymphocyte reaction MLR In each case indicate which lymphocyte population bath neither population 1 or population 2 you would expect to proliferate 6pts Remember in a MLR T cells are responding reacting with MHC hop botype that is not their own The MHC is the antigen in this assay In MLR Tucells proliferate Mice Strains Population 1 Mouse A H 2 Mouse A H 2 Mouse A H 2 C57BL 6 H 2 Mouse A CBA H 2 Mouse B CBAx C57BL 6 offspring 4 2 Mouse AxB Population 2 Mouse B H 2 Mouse A H 2 mito mycin C treated killed cant proliferate Mouse B H 2 mitomycin C treated killed cant proliferate AxB offspring H 2 Mouse B H 2 Proliferation 48 8 IV a both b population 1
![If an antigen that produces immunity on a pathogen is a carbohydrate would it be possible to create and use a DNA vaccine to induce long term immunity against that antigen For the toolbar press ALT F10 PC or ALT FN F10 Mac 11 T](https://media.kunduz.com/media/sug-question-candidate/20230803014718793461-4322992.jpg?w=256)
Biology
Biotechnology: Principles and ProcessesIf an antigen that produces immunity on a pathogen is a carbohydrate would it be possible to create and use a DNA vaccine to induce long term immunity against that antigen For the toolbar press ALT F10 PC or ALT FN F10 Mac 11 T
![Proteins 7MRNA7 Enzymes Amino acid metabolism Metabolism Lipid metabolism Carbohydrate metabolism](https://media.kunduz.com/media/sug-question-candidate/20230802145219023449-5777534.jpg?w=256)
Biology
BiomoleculesProteins 7MRNA7 Enzymes Amino acid metabolism Metabolism Lipid metabolism Carbohydrate metabolism
![Below is a graphic that shows ways in which a mutation may influence the sequence of nucleotides in a gene and the structure of an associated protein Choose the correct answer from the drop down box No mutation AB CD EF McGraw Hill Education 3 CACGTGGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTAGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTGGAGTGAGGTCACCTC Val His Leu Thr Pro Wall Glu m CACGTGGAGTGAGGTATC CTC Val His Leu Thr Pro Stop 5](https://media.kunduz.com/media/sug-question-candidate/20230802061111327882-5799832.jpg?w=256)
Biology
Human Physiology - Chemical CoordinationBelow is a graphic that shows ways in which a mutation may influence the sequence of nucleotides in a gene and the structure of an associated protein Choose the correct answer from the drop down box No mutation AB CD EF McGraw Hill Education 3 CACGTGGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTAGAGTGAGGTCTC CTC Val His Leu Thr Pro Glu Glu CACGTGGAGTGAGGTCACCTC Val His Leu Thr Pro Wall Glu m CACGTGGAGTGAGGTATC CTC Val His Leu Thr Pro Stop 5
![pedigree ng pedigree plete the Aa paragraph OOC O 100 500 a At the top of the pedigree is the grandfather Based on the inheritance pattern of his offspring and knowing the genotype of the grandmother the grandfather s genotype is Click to select D As you examine the remaining part of the pedigree the diagram shows the inheritance of this particular trait is McGraw Hill Education ing the patten on](https://media.kunduz.com/media/sug-question-candidate/20230802054058268897-5799832.jpg?w=256)
Biology
Reproductive Healthpedigree ng pedigree plete the Aa paragraph OOC O 100 500 a At the top of the pedigree is the grandfather Based on the inheritance pattern of his offspring and knowing the genotype of the grandmother the grandfather s genotype is Click to select D As you examine the remaining part of the pedigree the diagram shows the inheritance of this particular trait is McGraw Hill Education ing the patten on
![Different methods of radiation Keyboard Navigable Alternate Version Complete the following paragraph concerning the different methods of radiation a Click to select cancer symptoms another type of cancer treatment uses energy to destroy cancer cells shrink tumors and ease 1 b Unlike Click to select which usually exposes the whole body to cancer fighting drugs radiation therapy can be directed against Click to select tissues and cells of the body There are two types of radiation treatment c Click to select uses a machine to aim beams of energy to specific parts of the body The most commonly used type of treatment radiation types vary from X rays to higher energy Click to select is a treatment in which a source of radiation is put inside the body Also known as the treatment involves a Click to select d Click to select Click to select to damage the DNA of the cancer cells that emits radioactive materials near the tumor](https://media.kunduz.com/media/sug-question-candidate/20230802051309906044-5799832.jpg?w=256)
Biology
Human Health and DiseasesDifferent methods of radiation Keyboard Navigable Alternate Version Complete the following paragraph concerning the different methods of radiation a Click to select cancer symptoms another type of cancer treatment uses energy to destroy cancer cells shrink tumors and ease 1 b Unlike Click to select which usually exposes the whole body to cancer fighting drugs radiation therapy can be directed against Click to select tissues and cells of the body There are two types of radiation treatment c Click to select uses a machine to aim beams of energy to specific parts of the body The most commonly used type of treatment radiation types vary from X rays to higher energy Click to select is a treatment in which a source of radiation is put inside the body Also known as the treatment involves a Click to select d Click to select Click to select to damage the DNA of the cancer cells that emits radioactive materials near the tumor
![Complete the sentences Each blank is worth 1 point Word bank to choose from disulfide bonds hydrogen bonds ionic bonds ion dipole interactions van der Waals interactions There are two types of non covalent interactions that contribute to the formation and stabilization of the DNA double helix structure Hydrogen bonds You are incorrect ionic bonds X X occur between the stacked bases of one strand and occur between the bases connecting two strands together](https://media.kunduz.com/media/sug-question-candidate/20230731204419250408-5777534.jpg?w=256)
Biology
BiomoleculesComplete the sentences Each blank is worth 1 point Word bank to choose from disulfide bonds hydrogen bonds ionic bonds ion dipole interactions van der Waals interactions There are two types of non covalent interactions that contribute to the formation and stabilization of the DNA double helix structure Hydrogen bonds You are incorrect ionic bonds X X occur between the stacked bases of one strand and occur between the bases connecting two strands together