Biology Questions

The mutant coding DNA strand 5 GGCCATGACAGAGGAGAAAAAGTTATTGCT 3 Write the mRNA sequence for this patient Write it 5 to 3 but only include the letters in the sequence ex ACGG in your answer Type your answer and submit 22 X X 5 CCGGUACUGUCUCCUCUUUUUUCAAUAACGAC 3 Hint coquence X

The type of photophosphoryla tion that is only involved in making energy not food is called A Chemiosmosis B linear photophosphorylation C cyclic photophosphorylation D basic photophosphorylation

fish appeared in the Silurian reached their greatest diversity in the Devonian a time known as the Age of Fishes and became extinct at the end of the Devonian They had no true teeth although the jaws had sharp tusklike projections and no preservable internal skeleton The only structure made of bone was the external armor Denver Museum of Nature Science Dunkleosteus an extinct Devonian marine placoderm fish found in Ohio The skull is more than 1 m high and 1 m wide Use these references to answer the questions below American Museum of Natural History Hall of Vertebrate Origins http www amnh org exhibitions permanent exhibitions fossil halls hall of vertebrate origins American Museum of Natural History Dunkleosteus http www amnh org exhibitions permanent exhibitions fossil halls hall of vertebrate origins dunkleosteus Anderson P S L Westneat M W 2007 Feeding mechanics and bite force modeling of the skull of Dunkleosteus terrelli an ancient apex predator Biology Letters 3 76 79 http rsbl royalsocietypublishing org content 3 1 77 full Cleveland Museum of Natural History Dunkleosteus terrelli http www cmnh org site AtThe Museum OnExhibit PermanentExhibits Dunk aspx University of California Museum of Paleontology 2000 Introduction to the Placodermi Extinct Armored Fishes with Jaws http www ucmp berkeley edu vertebrates basalfish placodermi html 39 In what formation were the Dunkleosteus fossils found 40 How long was Dunkleosteus 41 How much did Dunkleosteus weigh 42 Was Dunkleosteus a predator or a scavenger 43 What is suction feeding and how did it work feet tons 44 Dunkleosteus did not have teeth so how did it bite Describe the jaw and how it stayed sharp 45 How did its bite compare to other animals including fish mammals alligators and dinosaurs 46 What did Dunkleosteus eat Look at the skull of the Dunkleosteus in the photo Examine the eye Notice the sclerotic ring the bony structure in the eye socket for the protection of the eye All birds have this sclerotic ring It protects their eyes against rapid air pressure changes during flights It is also used to help the eye focus on distant objects Read more about the sclerotic ring here

33 Did they have gills 34 Did they have scales 35 Give the age period name and dates of the earliest fish from these two references 36 Where did Astraspis live List four states where they have been found THE EVOLUTION OF FISH WITH JAWS Jawed fish are gnathostomes as opposed to the ostracoderms or jawless fish The classification of the gnathostomes is shown in Box 12 2 A simplified version of some of the traditional nomenclature is included in blue Box 12 2 Classification of the Gnathostomes GNATHOSTOMES Osteostraci fossil armored jawless vertebrates called ostracoderms Gnathostomata vertebrates with jaws Placodermi placoderm fish armored jawed vertebrates Chondrichthyes sharks and rays Teleostomi teleost fish Acanthodii spiny fish Osteichthyes bony fish Actinopterygii ray finned fish most modern fish Sarcopterygii lobe finned fish and terrestrial vertebrates Class Sarcopterygii Coelacanthimorpha coelacanths Order Coelacanthiformes Dipnoi lung fish Subclass Dipnoi Onychodontiformes extinct fish Porolepimorpha extinct fish Osteolepimorpha extinct lobe finned fishes such Eusthenopteron Rhizodontimorpha extinct lobe finned fishes Terrestrial vertebrates Subclass Tetrapodomorph Janvier P 1997 Gnathostomata Jawed Vertebrates Tree of Life Web Project http tolweb org tree group Gnathostomata contgroup Vertebrata Scroll down to see the diagram relating jaws in red to gill arches in green in this reference Zimmer C 1996 Death From the Pleistocene Sky Discover 17 3 http discovermagazine com 1996 mar deathfromtheplei720 37 What animal is shown in the diagram with jaws and gill arches in the Gnathostomata reference Hint See the caption 38 What does the Zimmer article propose as a reason for the development of jaws

Latimeria a modern sarcopterygian coelacanth living near Madagascar Note the similarity of the tail to that of Eusthenopteron fossils in the previous figure The tail is very different from that of the ray finned fishes This example is about 2 m long From Levin H 2013 The Earth Through Time 10th edition figure 12 75 p 370 This material is reproduced with permission of John Wiley Sons Inc 55 Compare the shape of the tail of the living coelacanth to that of Eusthenopteron Describe the similarities and differences 56 Compare the tail of the coelacanth to that of the ray finned fishes from the Green River Formation In the boxes below sketch both and describe the differences Tail of Coelacanth Tail of ray finned fish 57 Describe the function of the swim bladder 58 Which type of fish was the most likely ancestor to the amphibians Some of the best preserved fossil fish are in the Green River Formation Eocene in Wyoming

John Wesley Dobbs Have you crossed John Wesley Dobbs Avenue on your way to class or heading for a friend s dorm But who was john Wesley Dobbs Dobbs grew up on a Cobb County farm with his grandparents farmers who had once been enslaved and came to Atlanta as a young man Remembered as a key community leader and advocate for Black success Dobbs raised a family and had a career working on the railroads for the Post Office In the 1930s and 40s you were likely to find him in this area talking to people on Auburn Avenue and the surrounding streets A large man with a booming voice Dobbs was a memorable speaker reminding listeners that bucks ballots and books were the key to effecting change Dobbs was a tireless advocate for success economically and politically Dobbs loved to walk the streets engaging many people in conversation and urged them on to new success You may also recognize Dobbs grandson Maynard Jackson who was the first Black mayor of Atlanta The mural shown below is near campus on Aub Avenue Dobbs is shown on the left with his grandson Maynard Jackson on the right CKSON SON MAYNARD JACKSON DOE

What are the proper triple examples for the abiotic components a Plants animals and nutrients O b Fungi water and soil O c Animals parasites and bacteria d Viruses nutrients and rocks e Water heat and solar energy

The analogues in an analogical argument are the things to which entities in a conclusion are being compared True False

Analogical arguments are arguments based on comparison True False

Which of the following options best describes this sentence Life is like a box of chocolates An argumentative analogy Not an analogy An illustrative analogy

The following is an analogy A rose is a rose is a rose True False

Select which of the four standard categorical forms best describes the following statement All dogs are not quadripeds Universal Affirmative UA Universal Negative UN Particular Negative PN Particular Affirmative PA

Which of the following options best describes the following statement Either you are going to win or you are going to lose It is a disjunction It is a conjunction It is a conditional It is a negation

A cell has completed G2 and moved on to M phase A spindle fiber has not properly connected to a kinetochore Which of the following will happen first in a healthy functioning cell O cyclin dependent kinases will be removed from the cytoplasm by enzyme degradation O The daughter cells will have unequal numbers of chromatids following anaphase The daughter cells will have unequal numbers of chromosomes following metaphase A regulatory signal will be sent to halt M phase moving forward until the spindle can connor

at which stage of Meiosis do daughter cells become haploid Following Prophase of Meiosis II O Following telophase of Meiosis II O Following anaphase of Meiosis II Following anaphase of Meiosis I

Paramecium aurelia is an organism that can reproduce both sexually and asexually It does not have cell walls or tissues To which kingdom does it belong O A Animalia OB Fungi O C Protista OD Plantae

6 Describe what happens during an action potential hint a labelled diagram may be useful

1 How did the leech get anesthetized

b How would blocking calcium not allow muscles to contract and paralyze the fish

8 When probing the leech which section of the neuron responded to the brush ex 1 mark central or outside neurons

a What protein does calcium bind to on the actin filament that initiates the sliding filament model ex muscle contraction

6 What are the 3 different tools used to stimulate the leech s skin

3 What neurotransmitter will not be released if calcium channels are blocked 1 mark

b What halts the gliding motion of the myofilaments

4 The muscle contracts when thin and thick filaments slide past each other What is this called 1 mark

1 Draw the synapse and identify the main parts of a pre synaptic cleft and a post synaptic 5 marks cleft include vesicles neurotransmitters receptor proteins or channels

a Explain the role of calcium in signaling an impulse to the motor neuron

5 How is an electrical synapse different from a chemical synapse

1 Muscles are striated What are the thick and thin filaments called that make the muscle 2 marks striated Identify which is thick and which is thin

4 What is an electrical synapse

3 What are neurotransmitters Include an example

4 What encases the leech s nerve cord

3 In step 5 of the procedure why can you not see the nervous system even though the other organ systems are present 1 mark

2 What part of the nerve cell is on the pre synaptic side hint the neuron that transmits the signal to the dendrite 1 mark

2 Inside the leech what type of blood is visible

Marsupial mammals Love the one you re with TO According to the phylogeny the bilby is most closely related to the devil

1 Biology scientific study of life CELL SYSTEM OF ORGANS ORGAN TISSUE CELL ORGANELLES MOLECULE ATOM ORGANISM BOMA POPULATION HERE BIOCENOSES ECOSYSTEM 2 Science Any method of learning about the natural world that follows the scientific method TUTUTUTUT 1

Supporting cell Olfactory bulb Olfactory gland Olfactory cilia Olfactory epithelium Olfactory stem cell Olfactory sensory neuron Mitral cell Olfactory tract 00 141 Route of inhaled air containing odor molecules Pearson Reset Help

Match the following sensory receptors to the stimuli they detect Match the words in the left column to the appropriate blanks in the sentences on the right Make certain each sentence is complete before submitting your answer thermoreceptors mechanoreceptors nociceptors photoreceptors chemoreceptors 3 4 5 stretch temperature light energy chemicals in solution pain Reset Help

Excessive UV radiation causes a healthy tan along with many skin and immune system benefits only causes tissue damage and skin cancer in people with fair skin can cause tissue damage and can alter the DNA of skin cells which may lead to skin cancer is a potential treatment for COVID 19 infection because it is harmless to human cells

Match the tissue type with its function protection from wear and tear supports and binds other tissues can act as a water reservoir filtration and exchange of substances via diffusion absorption and secretion withstand high tension and stretching particularly in one direction 1 Simple squamous epithelium 2 Simple columnar epithelium 3 Stratified squamous epithelium 4 Dense regular connective tissue 5 Areolar connective tissue

regions called median sagittal frontal transverse Question 3 2 points Listen Homeostasis gh the body dividing it into anterior and posterior is unimportant for our overall health helps keep our body functioning optimally by maintaining relatively stable conditions internally despite environmental changes refers to our body s response to infrequent events that do not require continuous adjustment

dy cavity houses the viscera whereas the ventral body cavity hoses the nervous system True False Question 5 2 points Listen Which of the following is false regarding water It helps to maintain temperature homeostasis by absorbing and releasing heat with little temperature change It is the most abundant and important inorganic compound in living organisms It is a necessary part of hydrolysis and dehydration synthesis reactions It is the universal solvent due to its poppolar properties

The sodium ion concentration is higher inside the cell than outside and the potassium ion concentration is higher outside the cell than inside True False

Detoxification of drugs Converting glycogen to free glucose Absorption synthesis and transport of fats Manufacturing of all secreted proteins Question 9 2 points a function of the smooth ER Listen Which of the following describes the plasma membrane a double layer of protein enclosing the plasma a single layered membrane that surrounds the nucleus of the cell a membrane composed of tiny shelves or cristae a phospholipid bilayer surrounding the cell

Match the cell junction with its description An impermeable junction formed by the fusion of integral proteins from adjacent cells 2 3 v 1 v Pores between adjacent cells that allow the exchange of small molecules An anchoring junction that helps bind adjacent cells into sheets 1 tight junction 2 desmosome 3 gap junction

does NOT characterize proteins Their function depends on their three dimensional shape They may be denatured by heat or acidity They have both functional and structural roles in the body They contain the genetic information of the cell Question 7 2 points Listen All ions are electrolytes because they can conduct an electrical current in solution True False

rough ducts are classified as ceruminous sebaceous exocrine endocrine Question 13 2 points Listen their products directly into the blood rather Select ALL of the following that are true of cardiac muscle cells They are considered involuntary muscle They contain multiple nuclei They are found only in the walls of the heart They branch and join

Functions of hair include Perception of insects on skin Prevention of heat loss Protection from sunlight All of the above

In endochondral ossification which tissue is the newly forming bone replacing fibrocartilage hyaline cartilage dense fibrous connective tissue elastic connective tissue